Лекарство афобазол инструкция: Страница не найдена

Содержание

АФОБАЗОЛ: инструкция, отзывы, аналоги, цена в аптеках

АФОБАЗОЛ: инструкция, отзывы, аналоги, цена в аптеках — Medcentre.com.ua
  1. Главная
  2. Лекарства
  3. АФОБАЗОЛ
4.6

173 756 просмотров

Как вы оцениваете эффективность АФОБАЗОЛ?

☆ ☆ ☆ ☆ ☆




Действующее вещество препарата Афобазол – избирательный анксиолитик, не относящийся к классу агонистов бенздиазепиновых рецепторов. Предупреждает развитие мембранозависимых изменений в рецепторах чувствительных к гамма-аминомасляной кислоте. Действие препарата не сопровождается гипноседативными эффектами. Не обладает миорелаксирующими свойствами, негативным действием на память и концентрацию внимания. Даже при длительном приеме Афобазола не развивается лекарственная зависимость, отсутствует синдром отмены. За счёт стабилизации мембран в ГАМК-рецепторах оказывает двойственное действие на организм человека, одновременно оказывая анксиолитическое (противотревожное) и легкое стимулирующее действие. Уменьшение психологического дискомфорта вызванного тревожными состояниями (озабоченность, плохие предчувствия, опасения, раздражительность) и последствиями нервного напряжения (пугливость, плаксивость, чувство беспокойства, неспособность расслабится, беспричинный страх, бессонница) приводят к улучшению общего состояния организма, в том числе улучшению физического состояния.

Состояние психологического благополучия приводит к улучшению состояния при различных соматических, вегетативных и когнитивных нарушениях. В том числе устраняет мышечные, сенсорные, сердечно-сосудистые, дыхательные, желудочно-кишечные симптомы при соматических нарушениях. Снижает частоту проявления вегетативных расстройств, в том числе сухость во рту, потливость, головокружение. Препарат повышает способность к концентрации внимания, улучшает память. Улучшение наблюдается на 5-7 день приема препарата. Максимальный эффект достигается на 4 неделе лечения и сохраняется после отмены препарата в среднем на 1-2 недели в зависимости от особенностей метаболизма каждого отдельного пациента. Эффективнее использовать препарат в терапии пациентов с преимущественно астеническими личностными чертами. Таким людям обычно свойственны мнительность, неуверенность, повышенная ранимость и эмоциональная лабильность. Препарат хорошо всасывается из кишечного тракта, имеет высокую степень связывания с белками плазмы и высокую степень сродства к клеткам организма. Препарат относится к категории препаратов, которые быстро выводятся из организма, таким образом, снижается вероятность развития передозировки Афобазола. Период полувыведения составляет 0,82 часа.

Показания к применению

Применяется у взрослых при тревожных состояниях: генерализованные тревожные расстройства, неврастения, расстройства адаптации.
При соматических заболеваниях: бронхиальная астма, синдром раздраженного кишечника, системная красная волчанка, гипертоническая болезнь, ишемическая болезнь сердца, аритмии.
При наличии показаний при дерматологических и онкологических заболеваниях.
При лечении нарушений сна, нейроциркуляторной дистонии, предменструального синдрома.
Для лечения алкогольного абстинентного синдрома, и облегчения синдрома отмены при отказе от курения.

Способ применения

Принимают внутрь, предпочтителен прием после приема пищи. Доза препарата подбирается индивидуально. Начальная разовая доза препарата 10мг, суточная – 30мг. В случае необходимости дозу увеличивают до 60мг в сутки. Курс лечения составляет 2-4 недели, при наличии показаний лечащий врач может продлить курс до 3 месяцев либо назначить повторный после некоторого промежутка времени.

Побочные действия

Возможно развитие аллергических реакций, тошнота, рвота, диарея.

Противопоказания

Детский возраст до 18 лет;
Период беременности и лактации;
Индивидуальная непереносимость компонентов препарата;
Непереносимость лактозы (гиполактазия).

Беременность

Применение препарата в период беременности противопоказан. Препарат выделяется с грудным молоком, поэтому при назначении препарата необходимо ставить вопрос о прекращении грудного вскармливания.

Взаимодействие с другими лекарственными средствами

Взаимное потенцирование наблюдается при одновременном приеме препарата Афобазол и диазепама. Усиливает противосудорожный эффект карбамазепина. Не оказывает влияния на наркотический эффект этанола и гипнотическое действие тиопентала.

Передозировка

При значительной передозировке возможно проявление седативного эффекта, а также повышенной сонливости без проявлений миорелаксации. Специфического антидота не существует. В качестве неотложной помощи допускается использование кофеин бензоат-натрия 20% раствор в ампулах по 1,0мл 2-3 раза в день подкожно.

Форма выпуска

Таблетки по 10 таблеток в контурной ячейковой упаковке по 3, 5 или 10 контурных упаковок в картонной коробке;
Таблетки по 25 таблеток в контурной ячейковой упаковке по 2 или 4 контурных упаковок в картонной коробке;
По 30, 50 или 100 таблеток в банке полимерной с крышкой.

Условия хранения

В защищенном от света и влаги месте, при температуре не выше 25 градусов Цельсия.
Срок годности – 2 года.

Состав

1 таблетка содержит:
Афобазол (в пересчете на сухое вещество) – 5 или 10мг;
Дополнительные вещества: крахмал картофельный, целлюлоза микрокристаллическая, сахар молочный (лактоза), повидон, магния стеарат.

Основні параметри

Название: АФОБАЗОЛ
Код АТХ: N05BX10 — Прочие

АФОБАЗОЛ отзывы

АФОБАЗОЛ цены в аптеках

АФОБАЗОЛ в наличии найдено в 7 аптеках

Афобазол табл. 10мг №60(20х3) ВАТФармстандарт-Лексредства, Россия 20757
Аптечна Крамниця Киев, вул. Попудренка, 26/9,

Время работы: Пн-Пт: 07:00-22:00, Сб-Вс: 08:00-22:00 Открыто

phoneВЫЗОВ directionsМаршрут
Афобазол таб.10 мг #60(20×3) 22455
АФОБАЗОЛ ТАБ.10МГ #60(20X3), ФАРМСТАНДАРТ-ЛЕКСТРЕДСТВА ОАО РОССИЯ 24415
АФОБАЗОЛ ТАБ.10МГ #60(20X3), ФАРМСТАНДАРТ-ЛЕКСТРЕДСТВА ОАО РОССИЯ 26605
Сервис поиска и доставки медпрепаратов «Будь-здоров» Доставка по Украине,

Время работы: Пн-Пт: 09:00-18:30, Сб-Вс: 09:00-17:00 Открыто

publicСАЙТ phoneВЫЗОВ directionsМаршрут
Афобазол таблетки 10 мг. №60 ОТИСИФАРМ 30000
Спецдоставка «Б.К.Сервис». Служба поиска и курьерской доставки Киев, вулиця Васильківська, 14 (офис),

Время работы: Пн-Пт: 10:00-17:00 Сейчас закрыто

publicСАЙТ phoneВЫЗОВ directionsМаршрут
Афобазол 10 мг Табл. №60 ОАО «Фармстандарт-Лексредства» 38500
Все аптеки

АФОБАЗОЛ аналоги

Аналоги подобраны по действующему веществу, показанию и способу применения

  • Инструкция по применению
    от 390 грн
    352671 просмотров

  • Инструкция по применению
    от 64 грн
    272110 просмотров

  • Инструкция по применению
    от 112 грн
    135224 просмотров

  • Инструкция по применению
    от 91 грн
    133338 просмотров

  • Инструкция по применению
    от 18 грн
    109157 просмотров

Все аналоги

Смотрите также

  • 5.0 1 отзыв

    118 просмотров

  • 5.0 1 отзыв

    582 просмотров

  • 5.0 10 отзывов

    1920 просмотров

  • 4.0 2 отзыва

    1782 просмотров

  • 2424 просмотров

  • 5.0 2 отзыва

    3057 просмотров

САМОЛЕЧЕНИЕ МОЖЕТ НАВРЕДИТЬ ВАШЕМУ ЗДОРОВЬЮ

Афобазол (Aphobazolum): описание, рецепт, инструкция

Aphobazolum

Аналоги (дженерики, синонимы)

Действующее вещество

Фабомотизол (Fabomotizolum)

Фармакологическая группа

Анксиолитики

Рецепт

Международный:

Rр.: Tab. «Aphobazolum» №50 

D.S.: По 1 таб. 2 р/д.

Россия:

Rр.: Tab. Fabomotizoli №50 

D.S.: По 1 таблетке 2 раза в день

Отпускается без рецепта

Фармакологическое действие

Афобазол — селективный небензодиазепиновый анксиолитик.
Действуя на σ1-рецепторы в нервных клетках головного мозга, стабилизирует ГАМК/бензодиазепиновые рецепторы и восстанавливает их чувствительность к эндогенным медиаторам торможения. Повышает биоэнергетический потенциал нервных клеток и защищает их от повреждения (оказывает нейропротективное действие).
Действие препарата реализуется преимущественно в виде сочетания анксиолитического (противотревожный) и легкого стимулирующего (активирующий) эффектов.
Афобазол уменьшает или устраняет чувство тревоги (озабоченность, плохие предчувствия, опасения, раздражительность), напряженность (пугливость, плаксивость, чувство беспокойства, неспособность расслабиться, бессонница, страх), соматические проявления тревоги (мышечные, сенсорные, сердечно-сосудистые, дыхательные, желудочно-кишечные симптомы), вегетативные нарушения (сухость во рту, потливость, головокружение), когнитивные расстройства (трудности при концентрации внимания, ослабленная память).

Особенно показано применение препарата у лиц с преимущественно астеническими личностными чертами в виде тревожной мнительности, неуверенности, повышенной ранимости и эмоциональной лабильности, склонности к эмоционально-стрессовым реакциям.
Эффект препарата развивается на 5–7-й день лечения. Максимальный эффект достигается к концу 4-й нед лечения и сохраняется после окончания лечения в среднем 1–2 нед. Афобазол® не вызывает мышечную слабость, сонливость и не обладает негативным влиянием на концентрацию внимания и память. При его применении не формируется лекарственная зависимость и не развивается синдром отмены.

Фармакодинамика

Данных по этому разделу нет. В текущий момент мы обрабатываем информацию, пожалуйста вернитесь позже.

Фармакокинетика

Данных по этому разделу нет. В текущий момент мы обрабатываем информацию, пожалуйста вернитесь позже.

Способ применения

Для взрослых:

Применяется внутрь, после еды.
Оптимальные разовые дозы — 10 мг; суточные — 30 мг, распределенные на 3 приема в течение дня.
Длительность курсового применения препарата составляет — 2-4 недели.
При необходимости, по рекомендации врача, суточная доза препарата может быть увеличена до 60 мг, а длительность лечения до 3 месяцев.

Показания

— генерализованные тревожные расстройства;
— неврастения;
— расстройства адаптации. У больных с различными соматическими заболеваниями:
— бронхиальная астма;
— синдром раздраженного кишечника;
— системная красная волчанка;
— ишемическая болезнь сердца;
— гипертоническая болезнь;

— аритмии;
— дерматологических, онкологических и других заболеваниях. При лечении:
— нарушений сна, связанных с тревогой;
— нейроциркуляторной дистонии;
— предменструального синдрома;
— алкогольного абстинентного синдрома;
— для облегчения, синдрома «отмены» при отказе от курения.

Противопоказания

— индивидуальная непереносимость препарата.
— непереносимость галактозы, дефицит лактазы или глюкозо-галактозная мальабсорбция;
— беременность, период лактации;
— детский, возраст до 18 лет.

Особые указания

Данных по этому разделу нет. В текущий момент мы обрабатываем информацию, пожалуйста вернитесь позже.

Побочные действия

Возможны аллергические реакции.
Редко — головная боль, которая обычно проходит самостоятельно и не требует отмены препарата.

Передозировка

Данных по этому разделу нет. В текущий момент мы обрабатываем информацию, пожалуйста вернитесь позже.

Лекарственное взаимодействие

Данных по этому разделу нет. В текущий момент мы обрабатываем информацию, пожалуйста вернитесь позже.

Форма выпуска

Таб. 5 мг: 20, 30, 50 или 100 шт.
Форма выпуска, состав и упаковка Таблетки белого или белого с кремоватым оттенком цвета, плоскоцилиндрические, с фаской.
1 таб.
морфолиноэтилтиоэтоксибензимидазола
дигидрохлорид 5 мг

Вспомогательные вещества: крахмал картофельный, целлюлоза микрокристаллическая, лактоза, повидон, магния стеарат.
20 шт. — упаковки ячейковые контурные (1) — пачки картонные.
10 шт. — упаковки ячейковые контурные (5) — пачки картонные.
25 шт. — упаковки ячейковые контурные (2) — пачки картонные.
30 шт. — банки полимерные (1) — пачки картонные.
50 шт. — банки полимерные (1) — пачки картонные.
100 шт. — банки полимерные (1) — пачки картонные.

АФОБАЗОЛ ИНСТРУКЦИЯ отзывы — развод или правда?

Моё знакомство с Афобазолом состоялось очень давно. Тогда я еще не подозревала о своем диагнозе Рассеянный склероз, но проблемы со сном преследовали меня давно и тогла моя бессонница казалась мне основной пробоемой в жизни. Тогда во время посещения врача я об этом упомянула, на что доктор посоветовал мне «успокоительное».

Того препарата, который мне назначил врач, в аптеке у дома не было и я решила приобрести афобазол, тогда как раз его очень активно рекламировали.

Афобазол действительно работает. Первые три-пять дней приёма афобазола я чувствовала себя мегаспокойно, даже если бы под моими окнами приземлился бы инопланетый корабль, я бы никак не отреагировала на эту эпидерсию и продолжила бы делатьь свои дела. То есть, приняв одну талетку афобазола с утра, она действовала бы часов до 15:00-16:00 дня. А это вполне достойный результат! К тому же ни каких побочных эффектов после приёма афобазола я не почувствовала.

Первый и основной недостаток это привыкание! Я имею в виду не зависимость, а именно привыкание. То есть где-то на 6-7 день приёма афобазола я начала понимать, что афобазол перестал действовать, то есть я с детства очень эмоциональный и впечатлительный человек, и это очень портит жизнь, ведь даже какая-то самая незначительная неприятность может испортить настроение на целый день, а это значит, что к вечеру я себя накручу так, что не усну.

Поэтому с утра, когда я очень раздражительная мне просто необходимо успокоительное. Но увы афобазолу удалось недолго трудиться над моим настроением.

3. Подводим итоги.

К сожалению, абсолютно ни один «успокоительный» препарат не решит наши проблемы надолго или навсегда. Тут либо нужно менять восприятие ситуации, что получается крайне редко, либо постепенно «повышать градус» препаратов, так сказать. Что приведет к очень плачевным результатам. К тому же если бы мы знали способ как не нервничать, не переживать и не бояться мы бы жили очень долго и счастливо.

Перед применением обязательно проконсультируйтесь со специалистом


Видео обзор

Все(5)

инструкция по применению и особенности

Афобазол относится к категории препаратов из группы аксиолитиков. Это означает, что лекарство направлено на снижение тревоги. Главным действующим веществом выступает афобазол, в честь которого и назвали сам медикамент.

Фармакологическое действие Афобазола

В инструкции по применению Афобазола сказано, что лекарственное средство направлено на снижение тревоги. Отличительной чертой препарата выступает отсутствие зависимости даже при длительном употреблении.

Средство не оказывает негативного воздействия на память и концентрацию внимания. Также оно не выступает стимулятором снижения мышечного тонуса, чем часто грешат аналоги дешевле. Подтверждают эту информацию от производителя и отзывы потребителей. Если пациент резко бросает принимать таблетки по каким-то причинам, то у него не прослеживается синдрома отмены. Это означает, что его самочувствие будет оставаться на прежнем уровне без значительного ухудшения текущего состояния.

Афобазол имеет двойное действие. Кроме снятия чувства постоянной тревоги он также выступает легким стимулятором. При регулярном приеме больной будет испытывать улучшение психического и физического состояния. Его нервное напряжение спадет.

Инструкция по применению Афобазола указывает на то, что основное действие средства позволяет устранить не только тревожность, но и симптомы со стороны таких систем организма:

  • сердечно-сосудистой,
  • желудочно-кишечной,
  • мышечной,
  • дыхательной.

Все они присутствуют при нарушениях соматического типа. Отдельно препарат работает над тем, чтобы снизить частоту вегетативных расстройств разного спектра, включающих:

  • ощущение сухости слизистых ротовой полости;
  • обильное потоотделение;
  • головокружение.

Отзывы пациентов подтверждают заявленные в инструкции улучшения памяти. Наблюдать первые улучшения можно уже на 5-7 день после начала регулярного приема. Далеко не все аналоги и заменители могут продемонстрировать столь высокий результат. Максимальный эффект можно наблюдать уже с третьей недели после начала приема. Сохраняется он около двух недель.

Точных данных по этому вопросу нет, так как у каждого пациента пик улучшения наступает по-разному в зависимости от особенностей метаболизма и первоначального состояния.

Афобазол часто назначают людям, которые постоянно испытывают:

  • эмоциональную неустойчивость,
  • неуверенность,
  • мнительность.

Показан он и ранимым потребителям.

Лекарство отлично всасывается в желудочно-кишечном тракте, а также обладает высокой степенью связывания с белками кровяной плазмы. Средство оперативно выводится из организма, что сводит риски получить передозировку к минимуму.

Терапевтическое действие Афобазола

С фармацевтической точки зрения лекарство представляет собой селективное средство противотревожного спектра действия. Такие медикаменты еще называют транквилизаторами.

Главным положительным отличием Афобазола считается отсутствие воздействия на бензодиазепиновые рецепторы, которые располагаются в структуре головного мозга. Антидепрессант имеет выборочное воздействие, затрагивая лишь нужные мозговые структуры. Это позволяет эффективно подавлять чувство тревожности, сохраняя умственные способности без изменений. Не сказывается он с негативной стороны на центральную нервную систему.

Пациент с купированной тревожностью пребывает в хорошем настроении, но при этом не испытывает вялости и сонливости, а также прочих сопутствующих симптомов заторможенности.

Отдельно выделяют неспособность Афобазола воздействовать на мышечную структуру тела. Из-за этого лекарство считается максимально безопасным для приема и его выбирают даже чаще, чем Тенотен или Атаракс. Но из-за своей избирательности лекарство работает не столь эффективно, как классические бензодиазепиновые медикаменты.

Из-за этого важно сначала проконсультироваться с врачом, который решит, можно ли обойтись простым Афобазолом, либо придется прописывать более тяжелые препараты. Но для гашения обычных страхов и тревожности его вполне хватает. Он отлично устраняет ощущение беспокойства, вызванного:

  • личными страхами,
  • переживаниями,
  • неприятными воспоминаниями,
  • волнениями,
  • легкими психическими расстройствами.

Если четко следовать прописанному курсу лечения и дозировке, то через время раздражительность у пациента сходит на нет. Он перестает постоянно опасаться чего-то неизвестного и выглядеть озабоченным.

Работает медикамент и в качестве защиты от напряжения с сопутствующими признаками вроде:

  • плаксивости,
  • пугливости,
  • невозможности расслабиться.

Назначают его и от бессонницы, которая часто сопровождается общим нервозным состоянием, вызванным жизнью в постоянном стрессе.

В отличие от многих других средств, вроде Тенотена или Новопассита, терапевтический эффект приема сохраняется приблизительно две недели после завершения употребления.

В качестве профилактики при нестабильном эмоциональном равновесии Афобазол могут назначить даже просто людям с астеническими чертами личности. Это позволит избавить их от излишне яркой реакции на окружающий негатив.

Показания к применению Афобазола

Каждый врач при осмотре пациента ориентируется на его конкретное самочувствие и перечень жалоб. Так как препарат влияет на психологическую сторону жизни пациента, назначать его можно только после обследования. А принимать нужно только под контролем врача. В противном случае самолечение может довести до экстренной госпитализации.

Состав препарата отлично помогает тем, кто страдает:

  • Различными тревожными состояниями. Это может быть как типичная неврастения, так и расстройство адаптации, и прочие общие психологические болезни в легкой степени течения.
  • Соматическими болезнями. К ним относят синдром раздраженного кишечника и ишемия. В группу потенциальных потребителей попали и те, кто страдает бронхиальной астмой, а также гипертонией, аритмией, системной красной волчанкой.
  • Онкологией. Таким больным, как и тем, кто страдает различными проявлениями дерматологических заболеваний, назначения проводится строго по показаниям.
  • Нарушениями, связанными со сном.
  • Нейроциркуляторной дистонией.
  • Абстинентным синдромом при алкогольной интоксикации (похмелье утром).
  • Предменструальным синдромом.

В некоторых случаях препарат могут назначить даже для облегчения неприятного состояния во время борьбы с табачной зависимостью.

Побочные эффекты и противопоказания

Побочные эффекты по сравнению с многочисленными аналогами крайне ограничены. Они включают в себя:

  • тошноту,
  • рвоту,
  • диарею.

Иногда организм пациента может ответить на прием медикамента аллергической реакцией. Но такие случаи считаются единичными.

Не особо большой перечень производитель составил и для противопоказаний. В список попали:

  • индивидуальная непереносимость компонентов препарата;
  • гиполактазия, что означает непереносимость лактозы;
  • нельзя давать лекарство детям в возрасте до 18 лет;
  • запрещен прием препарата при беременности и во время периода лактации.

Если молодым мамам без назначения не обойтись, то тогда малыша нужно перевести на искусственный формат питания. А во время беременности повышенное чувство тревожности стоит утилизировать другими более безопасными методами.

Случаи передозировки и возможность управлять механизмами

Если знать, как принимать лекарственный препарат правильно, то он не окажет негативного воздействия на способность управлять механизмами. Это означает, что у водителей за рулем он не будет вызывать сонливость.

Также он не сказывается негативно на сотрудниках, чья деятельность тесно связана с выполнением задач, требующих высокой скорости реакции. Он подходит для работников умственного и физического труда, которым требуется концентрация внимания.

Случаи передозировки обычно затрагивают ситуации, когда пациент за один прием превысил предельно допустимую разовую дозировку. Если же человек принял превышающую норму таблетки утром и вечером, то это не приведет к серьезным последствиям. Компоненты Афобазола не накапливаются в тканях и быстро выводятся естественным путем.

А вот одноразовое многократное превышение рекомендованной дозы приводит к развитию:

  • седативного эффекта,
  • сонливости,
  • расслабления мышц.

Эффективным антидотом тут признан кофеин бензонат натрия в растворе. Но вводить его должен только врач «скорой», который рассчитает нужную дозу, исходя из текущего положения дел.

Прием Афобазола и алкоголь

С алкоголем совместимость Афобозола считается оптимальной. Если во время курса лечения пациент употребил алкогольные напитки, то это не грозит ему тяжелой степенью интоксикации.

Но это правило распространяется только на течение взаимодействия с точки зрения фармакологической химии. Это означает, что правило основывается только на отсутствии негативных эффектов из-за предполагаемого взаимодействия лекарства и этилового спирта.

Крайне важно учитывать психический эффект, который оказывают оба действующих вещества. Из-за этого доктора рекомендуют не экспериментировать с собственным здоровьем и отложить выпивку до окончания курса лечения.

При этом препарат считается оптимальным для блокировки похмелья. Объясняется это тем, что традиционно абстинентный синдром сопровождается:

  • депрессией,
  • чувством вины,
  • некоторыми изменениями душевного состояния.

Афобазол успешно справляется с купированием тягостных психологических симптомов. Это гарантирует быстрое восстановление организма.

Использовать Афобазол для таких специфичных целей, как, впрочем, и для общего восстановления психики, нужно только после консультации с опытным специалистом.

Информация на нашем сайте предоставлена квалифицированными врачами и носит исключительно ознакомительный характер. Не занимайтесь самолечением! Обязательно обратитесь к специалисту!

Автор: Румянцев В. Г. Стаж 34 года.

Гастроэнтеролог, профессор, доктор медицинских наук. Назначает диагностику и проводит лечение. Эксперт группы по изучению воспалительных заболеваний. Автор более 300 научных работ.

Ринакантин С Уменьшает токсическое воздействие фибрилл амилоида-β на нейроны и ослабляет нейровоспаление, вызванное ЛПС, амилоидом-β и интерфероном-γ в глиальных клетках

Нейровоспаление играет центральную роль в патофизиологии болезни Альцгеймера (БА). Соединения, подавляющие нейровоспаление, были идентифицированы как потенциальные терапевтические мишени для БА. Ринакантин C (RC), сложный эфир нафтохинона, обнаруженный в Rhinacanthus nasutus Kurz (Acanthaceae), в настоящее время предлагается в качестве эффективной молекулы против воспаления.Однако точная роль RC в нейровоспалении еще предстоит выяснить. В настоящем исследовании мы исследовали влияние РК на модуляцию липополисахаридов (ЛПС), пептида амилоида- β (A β ) или интерферона- γ — (IFN- γ -), вызывающего патологические события в нейронах и глия. Наши результаты показали, что RC предотвращал индуцированную A β токсичность в нейронах гиппокампа крыс и ослаблял активируемую LPS продукцию оксида азота (NO), экспрессию индуцибельной синтазы оксида азота (iNOS) и передачу сигналов NF- κ B в глии крыс.Аналогично, RC подавлял индуцированное LPS нейровоспаление за счет снижения продукции NO и уровней мРНК iNOS, IL-1 β , CCL-2 и CCL-5 в микроглии крыс. Дальнейшие исследования с использованием микроглии BV-2 показали, что RC ингибирует LPS-, A β — и IFN- γ -стимулированную секрецию IL-6 и TNF- α . Следует отметить, что активация NF- κ B и ERK отменялась RC в ответе клеток BV-2 на A β или IFN- γ . Более того, РЦ защищал нейроны от A β -стимулируемой микроглией кондиционированной средозависимой токсичности.В совокупности эти данные подчеркивают благотворное влияние РК на нейропротекцию и подтверждают терапевтическое значение РК при состояниях, опосредованных нейровоспалением.

1. Введение

Нейровоспаление представляет собой воспалительную реакцию в центральной нервной системе (ЦНС) и в настоящее время является одним из основных компонентов патологии болезни Альцгеймера (БА) [1]. Особенности нейровоспаления включают инфильтрацию иммунных клеток, активацию глиальных клеток и продукцию медиаторов воспаления [2].Микроглия, резидентные фагоциты ЦНС, составляют примерно 5–12% популяции головного мозга [3]. Как и большинство тканевых макрофагов, микроглия патрулирует мозг в поисках патогенов и поддерживает гомеостаз и пластичность ЦНС с постоянной подвижностью [4]. При восприятии повреждений, таких как белковые агрегаты, микроглия реагирует, принимая набор морфологических и функциональных признаков, то есть «реактивный» или «примированный» [5]. Хотя реакция микроглии на повреждение обычно полезна, она может пойти не так, особенно в случаях хронического повреждения и длительного воспаления, например, при нейродегенеративных заболеваниях [6].В связи с тем, что повреждение нейронов при БА не может быть полностью объяснено «гипотезой амилоидного каскада» [7], больше внимания уделяется потенциальной роли микроглии в этиологии заболевания, чему способствуют убедительные генетические ассоциации между микроглиальными путями и БА [8]. , 9].

Контроль активации микроглии стал основной целью при БА и других нейродегенеративных заболеваниях старения [10]. Высокоактивированная микроглия была обнаружена в моделях AD у мышей Tg и у старых нормальных мышей [11, 12].Дополнительные доказательства исходят от присутствия микроглии, окружающей амилоидные бляшки в коре головного мозга при БА, и наличия отложений A β в Т-клетках, активированной микроглии и реактивных астроцитах в головном мозге пациентов с БА [13, 14]. Активированная микроглия высвобождает провоспалительные и цитотоксические факторы, в том числе TNF- α , IL-1 β , IL-6, оксид азота (NO) и активные формы кислорода (АФК) [15]. Эти медиаторы могут непосредственно индуцировать апоптоз нейронов или усиливать локальный воспалительный ответ, что приводит к возможной синаптической дисфункции или гибели нейронов [16].Повреждение или гибель нейронов также могут вызывать активацию микроглии, что способствует распространению локализованного пагубного цикла нейровоспаления [17]. Помимо прямого нейротоксического эффекта, активированная микроглия может способствовать отложению A β при воспалительных состояниях, что было изучено на моделях мышей и в головном мозге пациентов с БА [18, 19]. Фактически, микроглия обладает способностью фагоцитировать стрессированные или умирающие нейроны и экспрессировать фагоцитарные рецепторы на их поверхности [20]. Обнаружено, что воспалительные стимулы, активирующие микроглиальный фагоцитоз нейронов, включают липополисахарид (LPS) и IFN- γ , которые способны вызывать массивный воспалительный ответ, характеризующийся выработкой и секрецией IL-6, TNF- α , IL-1 β . , IL-12 и iNOS, все из которых могут вызывать нейротоксичность [21, 22].Кроме того, фибриллы A β также могут вызывать воспалительные процессы, связываясь с микроглией и активируя ее [23].

Ринакантин С (RC) представляет собой эфир нафтохинона, обнаруженный в Rhinacanthus nasutus (L.) Kurz (Acanthaceae) [24], который широко распространен в Юго-Восточной Азии для лечения диабета, гипертонии, гепатита, пневмонии, туберкулеза легких, рак и кожные заболевания [25–28]. Недавние исследования показали, что Rhinacanthus nasutus проявляет противовоспалительную [29] и нейропротективную активность против гипоксии, глутамата или A β , индуцированной гибели клеток [30, 31].В частности, лупеол, стигмастерол и β -ситостерол идентифицированы как молекулы, препятствующие токсичности глутамата. Кроме того, сообщалось, что РЦ проявляет различные биологические функции, в том числе антигипергликемическую, антигиперлипидемическую [32], противовоспалительную [33, 34], антиостеокластогенную [35], противоаллергическую [36], противоопухолевую [37], противомикробную [24, 38]. , 39] и противомоскитной [40] активностью. Что касается противовоспалительной активности, RC был способен снижать высвобождение NO и простагландина E2 в RAW264, стимулированном LPS.7 макрофагов [33] и ингибирует аномальный лизис кости, возникающий во время воспалительной резорбции кости [35]. Совсем недавно Chang и его коллеги продемонстрировали, что RC обладает нейропротекторным эффектом за счет модуляции нейровоспаления, связанного с высокоподвижным блоком 1 группы, и ослабления апоптоза головного мозга в модели субарахноидального кровоизлияния у крыс [34]. Хотя RC участвует в регуляции различных воспалительных процессов, точная роль RC в нейровоспалении еще предстоит выяснить. Целью этого исследования является изучение того, может ли RC модулировать глиальные функции, в рамках попытки понять возможные иммуномодулирующие свойства этого соединения и механизмы его функционирования против нейровоспаления.

2. Материалы и методы
2.1. Культура клеток

Все эксперименты с участием животных были одобрены Институциональным комитетом по уходу и использованию животных Национального университета Цинхуа (NTHU-0010327). Первичные нейроны гиппокампа получали из эмбрионального мозга крыс Sprague Dawley (BioLASCO Taiwan, Taipei, Taiwan) на 18-й день эмбрионального развития (E18), как описано ранее [41] с небольшими модификациями. Вкратце, гиппокампы вырезали в сбалансированном солевом растворе Хенкса (HBSS) с последующей инкубацией с папаином (10 ЕД/мл) при 37°C в течение 10 мин.После инкубации с ДНКазой I (Sigma-Aldrich, Сент-Луис, Миссури, США) при 37°C в течение дополнительных 10 мин ткани механически диспергировали путем растирания пастеровской пипеткой. Клетки собирали центрифугированием при 1000 об/мин в течение 5 мин и ресуспендировали в среде для посева (MEM, содержащая 10% ( об./об. ) лошадиной сыворотки, 100 ед./мл пенициллина и 100 мкг/мл мкг/мл стрептомицина). После фильтрации через нейлоновую сетку 70 микрон (Greiner Bio-One, Frickenhausen, Germany) клетки высевали на планшеты или чашки, покрытые поли-L-лизином, с плотностью 2.5 × 10 4 клеток/см 2 . Через 12–16 ч среду для посева заменяли нейробазальной средой, содержащей 2 % ( по объему ) B27, 0,5 мМ глутамина, 100 ЕД/мл пенициллина и 100 мкг/мл стрептомицина (все от Thermo Fisher). Scientific, Уолтем, Массачусетс, США). Клеткам давали созреть in vitro в течение по меньшей мере 8 дней до обработки, и половину среды заменяли свежей нейробазальной средой каждые 3-4 дня. Чистоту этих культур оценивали с помощью иммуноокрашивания специфическими маркерами нейронов ( β -III тубулина) и астроцитов (GFAP) с >95% положительными для β -III тубулина.

Первичные культуры кортикальной глии получали из эмбрионального мозга крыс Sprague Dawley на 18-й день эмбрионального развития (E18). Кору головного мозга рассекали в HBSS с последующей инкубацией с 0,25% ( мас./об. ) трипсина при 37°C в течение 15 мин. После инкубации с ДНКазой I (Sigma-Aldrich) в течение дополнительных 5 мин корковое вещество механически диспергировали путем растирания пастеровской пипеткой. Диссоциированные клетки коры головного мозга собирали центрифугированием при 1000 об/мин в течение 5 мин и ресуспендировали в среде для посева (MEM с добавлением 5% ( об./об. ) лошадиной сыворотки, 5% ( об./об. ) эмбриональной бычьей сыворотки (FBS), 100 Ед/мл пенициллина и 100  мк мкг/мл стрептомицина).Если не указано иное, все реагенты для культивирования клеток были приобретены у компании Thermo Fisher Scientific. После фильтрации через нейлоновую сетку 40  мкм мкм (Greiner Bio-One) клетки высевали в колбы, покрытые поли-L-лизином, в количестве 5 × 10 4 клеток/см 2 . Клетки содержали во влажной атмосфере 5% CO 2 при 37°С, среду меняли каждые 3-4 дня. Эксперименты проводили на 8-10 сутки in vitro . Эти культуры содержат 95% астроцитов, как определено с помощью иммунофлуоресцентной микроскопии с использованием моноклонального антитела, специфичного к GFAP.

Первичную микроглию получали из смешанных культур кортикальной астроглии/микроглии путем встряхивания колб при 200 об/мин в течение 2 ч при 37°C. После центрифугирования при 2000 ×g в течение 5 мин полученный клеточный осадок ресуспендировали в среде N2 (50% ( об./об. ) нейробазальной, 50% ( об./об. ) MEM, 1% ( об./об. ). ) добавка N2, 100 ЕД/мл пенициллина, 100 мкг/мл стрептомицина и 2 мМ глутамина) и высевали на чашки диаметром 60 мм, 6-луночные планшеты, 12-луночные планшеты или 96-луночные планшеты по мере необходимости.Чистота этих культур обычно составляет >97% микроглии, как определено иммуноокрашиванием с использованием антитела против Iba-1 (Wako Chemicals, Ричмонд, Вирджиния, США).

Линия клеток микроглии мыши BV-2 была любезным подарком доктора Чиоу-Фэн Линь (кафедра микробиологии и иммунологии Тайбэйского медицинского университета, Тайвань). Клетки поддерживали в среде RPMI-1640 с добавлением 10% FBS, 100 ЕД/мл пенициллина и 100  мк мкг/мл стрептомицина (все от Thermo Fisher Scientific) при 37°C, 5% CO 2 и гальванопластика плотностью 2.5 × 10 4 клеток/см 2 на 6-луночные планшеты, 12-луночные планшеты или 96-луночные планшеты по мере необходимости.

2.2. Получение ринакантина C

Ринакантин C (RC) был выделен из Rhinacanthus nasutus , предоставленного AOB KEIOH GROUP Corp. 1 ч. Экстракт 90% этанола (77,82 г) затем разделяли с 90% метанолом и н -гексаном.Слой 90% метанола концентрировали с получением коричневого сиропа (54,32 г) и далее распределяли между CH 2 Cl 2 и водой. Слой CH 2 Cl 2 концентрировали с получением коричневого сиропа (27,55 г), 2,50 г которого хроматографировали на колонке с силикагелем, элюируя смесью н -гексан/EtOAc ( об/об , 4 : 1) для получения RC (444,2 мг) после концентрирования. РЦ растворяли в диметилсульфоксиде (ДМСО) до концентрации 10 мМ, аликвоты хранили при –20°С.

2.3. Обработка клеток

Во всех экспериментах клеткам давали прикрепляться в течение 24 часов, а затем стимулировали A β , LPS или IFN- γ в течение 24 или 48 часов, если не указано иное. Там, где указано, RC добавляли за 1–4 часа до этого.

2.4. Препарат A
β Fibrils

A β 25–35 (Gly-Ser-Asn-Lys-Gly-Ala-Ile-Ile-Gly-Leu-Met) был приобретен у Sigma-Aldrich. Один миллиграмм пептида A β растворяли в 1 мл дистиллированной воды до концентрации 1 мг/мл.Для получения фибрилл А β раствор инкубировали при 37°С в течение 7 дней. Аликвоты маточных растворов хранили при -20°С. Образование фибрилл исследовали с помощью просвечивающей электронной микроскопии.

2.5. Электронная микроскопия

Фибриллы A β , распределенные по покрытым углеродом медным сеткам (Ted Pella Inc., Реддинг, Калифорния, США), окрашивали отрицательно 1% ( мас./об. ) уранилацетата (Electron Microscopy Sciences, Hatfield, США). Пенсильвания, США) и исследовали на просвечивающем электронном микроскопе HT7700 (HT7700, Hitachi High-Technologies, Tokyo, Japan) при ускоряющем напряжении 100 кВ.Изображения были получены с помощью камеры CCD (устройство с зарядовой связью) перед дальнейшей обработкой в ​​Adobe Photoshop CS6 (Adobe, Сан-Хосе, Калифорния, США).

2.6. Фазово-контрастная микроскопия

Первичные нейроны крысы на поли-L-лизине обрабатывали 25  μ M A β в течение 24 часов. Изображения были получены с помощью светового микроскопа Zeiss Axiovert 40C (Carl Zeiss, Йена, Германия) с 20-кратным объективом.

2.7. Иммунофлуоресцентная микроскопия

Для двукратной иммунофлуоресцентной микроскопии клетки фиксировали в 4% ( мас./об. ) параформальдегиде (PFA) (Electron Microscopy Sciences, Hatfield, PA, USA) в фосфатно-солевом буфере (PBS) в течение 10 мин. и проницаемость с 0.2% ( об./об. ) Triton X-100 в PBS в течение 5 мин при комнатной температуре. Если не указано иное, все следующие стадии проводили при комнатной температуре. После 5-минутной промывки 0,1% ( мас./об. ) бычьего сывороточного альбумина (БСА) (Sigma-Aldrich, Сент-Луис, Миссури, США) в PBS клетки блокировались 10% ( мас./об. ). ) нормальная козья сыворотка (NGS) (Jackson ImmunoResearch Laboratories, West Grove, PA, USA) в PBS в течение 20 мин. После промывания PBS клетки инкубировали с первичными антителами в течение 1 ч.Первичными антителами, использованными в этом исследовании, были анти- β -III тубулин (1 : 400; BioLegend, Сан-Диего, Калифорния, США), расщепленная каспаза-3 (1 : 200; Cell Signaling Technology, Беверли, Массачусетс, США). , и тубулиновое антитело, генерируемое каспазой-6 (1 : 500; тубулин ΔCsp6), любезно предоставленное профессором Андреа С. Леблан (Центр исследований старения Блумфилда, Институт медицинских исследований леди Дэвис, Еврейская больница общего профиля, Канада) [42] . Клетки трижды промывали 0,1% ( вес/объем ) BSA в PBS с последующей инкубацией в течение 1 часа с Alexa Fluor® 488 (1 : 500) или конъюгированным с Alexa Fluor 594 (1 : 500) козьим антимышиным , антикроличьи или антикрысиные вторичные антитела (Thermo Fisher Scientific).Все антитела разводили в PBS, содержащем 1% ( мас./об. ) NGS. В некоторых экспериментах клетки докрашивали 25 нг/мл 4,6-диамидино-2-фенилиндола (DAPI; Thermo Fisher Scientific) для визуализации ядер. После установки на предметные стекла с помощью раствора для крепления микроскопа ReadiUse™ (AAT Bioquest, Саннивейл, Калифорния, США) покровные стекла исследовали с помощью конфокального лазерного сканирующего микроскопа LSM 510 (Carl Zeiss, Йена, Германия) с числовой апертурой 40x (0,75) NA]) Объектив План-Неофлуар Апохромат.Изображения были собраны в многодорожечном режиме с помощью программного обеспечения LSM 510 с оптическими сечениями 1,0   мкм м и обработаны для изображений с использованием Photoshop CS6 (Adobe, Сан-Хосе, Калифорния, США).

2.8. Фракционирование клеток и иммуноблоттинг

Первичные нейроны гиппокампа крыс, выращенные на чашках, промывали PBS и лизировали с использованием лизирующего буфера для радиоиммунопреципитации (RIPA) (1% ( об./об. ) Triton X-100, 0,5% ( мас./об. ). ) дезоксихолат натрия, 0,1% ( w/v ) SDS, 150 мМ NaCl, 50 мМ Трис-HCl, pH 8, 2 мМ EGTA) с добавлением 1 мМ фенилметилсульфонилфторида (PMSF), коктейля ингибиторов протеаз (Roche, Мангейм, Германия) и ингибиторы фосфатазы (Merck Millipore, Биллерика, Массачусетс, США).Затем клеточные лизаты гомогенизировали на льду в гомогенизаторе Dounce объемом 1 мл (Wheaton, Millville, NJ, USA). После определения концентрации белка общие клеточные лизаты центрифугировали при 16000×g в течение 10 минут при 4°C в настольной центрифуге (Eppendorf AG, Гамбург, Германия). Полученные супернатанты собирали в виде растворимых фракций, а оставшиеся осадки, представляющие собой нерастворимые фракции, ресуспендировали в буфере для образцов Лэммли [43] в объеме, эквивалентном супернатанту.В некоторых экспериментах с первичными глиальными клетками крысы лизаты цельных клеток собирали в буфере RIPA. Там, где это указано, глиальные клетки лизировали с использованием набора для выделения ядер/цитоза (BioVision, Milpitas, CA), а цитозольные и ядерные фракции разделяли в соответствии с протоколом производителя.

Иммуноблоттинг проводили с использованием системы влажного электрофоретического переноса (Bio-Rad, Hercules, CA, USA) в соответствии с инструкциями производителя. Мембраны промывали трис-буферным раствором (TBS, 150 мМ NaCl, 20 мМ Трис-HCl, pH 7.4) три раза с последующей инкубацией в блокирующем буфере (3% ( вес/объем ) BSA в TBS, содержащем 0,1% ( объем/объем ) Tween 20) в течение 1 часа при комнатной температуре. Использовали следующие первичные антитела: тубулин β -III (1 : 5000; BioLegend), расщепленную каспазу-3 (1 : 5000; Cell Signaling Technology), тубулин ΔCsp6 (1 : 5000; от профессора Андреа С. ЛеБлан) [ 42], iNOS (1 : 5000; Novus Biologicals, Литтлтон, Колорадо, США), NF- κ B p65 (1 : 5000; Cell Signaling Technology), ламин A/C (1 : 5000; Cell Signaling Technology), и β -актин (1 : 5000; Novus Biologicals).После промывания TBS, содержащим 0,1% ( об./об. ) Tween 20, мембраны инкубировали с конъюгированными с пероксидазой хрена (HRP-) козьими антимышиными, антикроличьими или антикрысиными вторичными антителами (Jackson ImmunoResearch Laboratories). в течение 2 часов при комнатной температуре. Активность пероксидазы выявляли с использованием набора для обнаружения усиленной хемилюминесценции (ECL) (Thermo Fisher Scientific) и визуализировали с помощью системы визуализации LAS 4000 (GE Healthcare, Чикаго, Иллинойс, США). Сила сигналов была количественно определена с использованием ImageQuant TL 7.0 (IQTL ver 7.0, GE Healthcare) и скорректированы по белковой нагрузке путем нормализации до β -актина или ламина A/C.

2.9. Анализ роста нейритов

Первичные культуры гиппокампа крыс получали из эмбрионов крыс Sprague Dawley и дифференцировали в течение 10 дней при 37°C во влажном инкубаторе с 5% CO 2 перед обработкой. Для исследования влияния РЦ на рост нейритов через 1 ч после обработки РЦ в культуру клеток добавляли 5  мк МА β 25–35 на 24 ч.Клетки подвергали флуоресцентному иммуноокрашиванию. После фиксации 4% PFA клетки пермеабилизировали с помощью Triton X-100 и инкубировали с антителом к ​​тубулину β -III (BioLegend) в течение 1 часа при комнатной температуре с последующей инкубацией с конъюгированным с Alexa Fluor 488 козьим антимышиным вторичным антителом. (Термо Фишер Сайентифик). Клетки помещали на покровные стекла и наблюдали под конфокальным лазерным микроскопом. Количественно определяли три микроскопических поля на лунку для каждого условия. Площадь тубулина β -III была количественно определена с использованием ImageJ, как описано ранее [44].Общая длина нейритов определялась с помощью NeuronJ [45], а масштабная линейка использовалась в качестве эталона размера.

2.10. Обработка нейронов микроглиальными кондиционированными средами

Микроглия, высеянная на покрытые поли-L-лизином 12-луночные планшеты с плотностью 1 × 10 5 клеток/лунка, была обработана 5  мк M A β или наличие RC в течение 24 часов. Как указано, клетки предварительно обрабатывали в течение 1 часа 0,5  мкМ М RC. Среды, кондиционированные микроглией, собирали, центрифугировали при 2000×g в течение 5 минут и фильтровали через 0.2  Шприцевые фильтры мкм м (Pall Corporation, Гамбург, Нью-Йорк, США). Первичные нейроны гиппокампа, культивированные в течение 14 дней, обрабатывали 50% кондиционированной микроглиальной средой в течение 24 часов перед окрашиванием антителом против тау-белка (1 : 500, Cell Signaling Technology) для специфической маркировки аксонов для анализа иммунофлуоресцентной микроскопии. Тау-положительная область была количественно определена с помощью ImageJ, а длина аксона была измерена с помощью NeuronJ.

2.11. Колориметрический анализ МТТ

Метаболическую жизнеспособность культивируемых клеток измеряли с помощью колориметрического МТТ (бромид 3-(4,5-диметилтиазол-2-ил)-2,5-дифенилтетразолия) (Thermo Fisher Scientific).Раствор МТТ (конечная концентрация 0,5 мг/мл) добавляли к культивируемым клеткам и инкубировали в течение 4 ч и 1,5 ч для первичных клеток и клеток BV-2 соответственно. После инкубации клетки лизировали и МТТ-формазан солюбилизировали в ДМСО с помощью орбитального шейкера в течение 5 мин. Оптическую плотность каждого образца определяли с использованием ридера микропланшетов SpectraMax ® M5 (Molecular Devices, Саннивейл, Калифорния, США) при 570 нм.

2.12. Анализ высвобождения ЛДГ

Повреждение клеток количественно оценивали путем измерения лактатдегидрогеназы (ЛДГ) в среде.Вкратце, собирали бесклеточную культуральную среду и измеряли количество выделившейся в среду ЛДГ с использованием набора для обнаружения цитотоксичности (Roche) в соответствии с протоколом производителя. Результаты считывали на ридере для микропланшетов SpectraMax M5 (Molecular Devices). Количество образовавшегося красного формазанового продукта пропорционально количеству лизированных клеток. Процент повреждения клеток определяли как экспериментальное высвобождение ЛДГ/общее высвобождение ЛДГ после смерти, вызванной лизирующим буфером × 100,

2.13. Иммуноферментный анализ (ELISA)

. После стимуляции клеток LPS, A β и IFN- γ супернатанты собирали и анализировали с использованием коммерческих наборов ELISA в соответствии с инструкциями производителя. Все наборы мышиного IL-6, TNF- α и CCL-2 были получены от eBioscience (Сан-Диего, Калифорния, США), а набор для мышиного CCL-5 ELISA был приобретен у R&D (Миннеаполис, Миннесота, США).

2.14. Измерение образования NO

Концентрации NO определяли путем измерения нитритов, выделяемых в культуральные супернатанты, с использованием системы реагентов Грисса (Promega, Madison, WI, USA).Пятьдесят микролитров супернатантов клеточных культур инкубировали со 100  мкл л реагента Грисса в каждой лунке полупрозрачного 96-луночного планшета. После инкубации в течение 10 мин при комнатной температуре измеряли оптическую плотность при 550 нм на ридере для микропланшетов SpectraMax M5 (Molecular Devices). Концентрации нитрита рассчитывали на основе эталонной кривой нитрита натрия.

2.15. Иммуноблоттинг-анализ клеток BV-2

Полные клеточные лизаты экстрагировали буфером для лизиса RIPA, дополненным коктейлем ингибиторов протеазы, коктейлем ингибиторов фосфатазы и 1 мМ PMSF (все от Sigma-Aldrich).Уровни белка определяли с использованием реактива Бредфорда (Sigma-Aldrich). Равные количества образцов белка (20–80  мк г) разделяли на геле NuPAGE 4–12% Bis-Tris (Thermo Fisher Scientific) и переносили на поливинилидендифторидную мембрану (Amersham Biosciences, Piscataway, NJ, USA) методом Система сухого блоттинга iBlot® (Thermo Fisher Scientific). Мембраны блоттировали первичными антителами против фосфо-NF- к В р65 (Ser536, 1 :1000), NF- к В р65 (1 :1000), фосфо-ERK1/2 (Thr202/Tyr204, 1): 1000), ERK1/2 (1 : 1000) и β -актин (1 : 10000) (все от Cell Signaling Technology), а затем вторичное антитело, конъюгированное с HRP (Санта-Крус, Даллас, Техас, США).Мембраны были разработаны с использованием набора Immobilon Kit (Merck Millipore, Дармштадт, Германия) в соответствии с инструкциями производителя и визуализированы с помощью системы визуализации BioSpectrum® (UVP; Кембридж, Великобритания). Цифровые изображения были количественно оценены с помощью денситометрии с использованием AlphaImager 2200 v4.0 (Alpha Innotech Corporation, Калифорния, США) и скорректированы на белковую нагрузку путем нормализации до β -актина.

2.16. Количественный ПЦР-анализ в реальном времени

Информационную РНК (мРНК) экстрагировали из клеток с использованием набора для очистки РНК GeneJET (Thermo Fisher Scientific) в соответствии с инструкциями производителя.кДНК первой цепи синтезировали с использованием 1  мкг мкг тотальной РНК (набор для синтеза кДНК первой цепи RevertAid™). Праймеры были разработаны с использованием библиотеки Roche Universal ProbeLibrary (UPL) (https://lifescience.roche.com/global_en.html) и подвергнуты анализу BLAST для оценки их специфичности. Праймеры, используемые в этом исследовании, перечислены в таблице 1 и были оценены экспериментально с помощью ПЦР и электрофореза в агарозном геле до проведения количественных экспериментов ПЦР в реальном времени (кПЦР).Специфичность праймеров подтверждалась наличием одного пика на кривой плавления, построенной для генов. Эффективность усиления варьировалась от 94,1% до 104,3%. qPCR проводили с использованием Maxima SYBR Green qPCR Master Mix и запускали на системе ПЦР в реальном времени StepOnePlus (все от Thermo Fisher Scientific). Количественное определение РНК определяли путем сравнения числа пороговых циклов каждого гена с геном GAPDH с использованием метода 2- △△Ct .

6
Nos2 CCL5 GAPDH

Gene Номер вступления Forveral (5-3) Revormance (5-3)

IL1B NM_031512.2 TGTGATGAAAGACGGCACAC CTTCTTCTTTGGGTATTGTTTGG
NM_012611.3 AGGTTGGAGGCCTTGTGTC GCTTCAGAATGGGGAGCTG
NM_031116.3 CTCACCGTCATCCTCGTTG GAGTGGTGTCCGAGCCATA
CCL2 NM_031530.1 CGTGCTGTCTCAGCCAGAT GGATCATCTTGCCAGTGAATG
Iba1 NM_017193 CCGAGGAGACGTTCAGTTACTC TGGCTTCTGGTGTTCTTTGTT
NM_017008.4 ATGGCCTTCCGTGTTCCTAC GCCTGCTTCACCACCTTCTT

2,17. Статистический анализ

Все количественные показатели представлены как среднее ± стандартная ошибка среднего или SEM. Статистические различия между группами лечения были проанализированы с помощью однофакторного дисперсионного анализа с последующим апостериорным тестом множественных сравнений Даннета.Альтернативно, тест Стьюдента t использовали для сравнения двух образцов, как указано в подписях к рисункам. считалось статистически значимым.

3. Результаты и обсуждение
3.1. RC защищает нейроны от Fibrillar A
β Токсичность

В качестве первоначальной оценки мы исследовали, является ли RC непосредственно токсичным для нейронов, инкубируя нейроны гиппокампа крысы с концентрациями 0,125–1  μ M RC в течение 24 часов. Анализ МТТ не выявил значительной токсичности в этих культурах с 0.125, 0,25 или 0,5  мк М КС (рис. 1, а). Основываясь на этих результатах, мы решили использовать для наших исследований концентрации RC на уровне 0,5  мк М или ниже, если не указано иное.

Накопленные данные свидетельствуют о том, что нейротоксичность агрегированных изоформ A β может вызывать нейродегенерацию при БА [46]. Чтобы выяснить, способствует ли RC выживанию нейронов после повреждения A β , мы обработали нейроны гиппокампа крысы фибриллами A β 25–35 (рис. 1(b)) по своим характеристикам, имитирующим полную длину A β , чтобы вызвать нейрональные усадка (рис. 1(c), стрелки) и разрушение нейритов (рис. 1(c), наконечники стрелок) и апоптотические реакции, на которые указывает расщепленный каспазой-6 α -тубулин (рис. 1(d), красный канал; рис. 1 (e), дорожка 3) и фрагмент, расщепленный каспазой-3 (рис. 1(e), дорожка 3).Инкубация нейронов с 25  мк M A β 25–35 в течение 24 ч значительно снижала жизнеспособность клеток по сравнению с контрольными нейронами (рис. 1(f), ). Однако предварительная обработка RC значительно обращала вспять индуцированную A β 25–35 нейрональную токсичность при концентрациях 0,25  мк М (рис. 1(f), ) и 0,5  мк М RC (рис. 1(f)). , ).

3.2. RC способствует росту нейритов в стимулированных A
β нейронах

Токсические эффекты A β во время раннего прогрессирования AD включают патологические изменения морфологии нейронов, такие как потеря синапсов, дистрофия нейритов и упрощение дендритов [47].Учитывая, что RC проявляет обратную активность в отношении токсичности A β , возникает соблазн предположить, оказывает ли RC благотворное влияние на целостность нейритов после повреждений A β . Как показано на наших микрофотографиях, контрольные клетки демонстрировали экспрессию тубулина β -III и интактные клеточные тела со сложной сетью нейритов в нейронах гиппокампа крысы (рис. 2(а)). Хотя целостность нейронов (измеряемая как общая площадь β -III тубулина, нормализованная по проценту необработанных нейронов) значительно снижалась под действием A β в среднем на 50% через 24 часа (рис. 2(b), RC), RC восстанавливала нейрональную целостность нейронов гиппокампа, обработанных A β , до уровня необработанных нейронов (рис. 2(b), ).Нейропротекция RC против повреждения A β также была подтверждена измерением роста нейритов. В то время как A β значительно уменьшал длину нейритов в нейронах крыс (рис. 2(c), ), усиленный рост нейритов наблюдался в нейронах, инкубированных с RC (0,5  μ M), по сравнению с нейронами, обработанными A β (рис. 2(в), ). В совокупности эти результаты свидетельствуют о том, что RC обладает защитным потенциалом в отношении A β 25–35 -стимулированной токсичности и разрушения нейритов.Мы впервые сообщаем, что RC является мощной нейропротекторной молекулой против фибрилл A β , которые считаются одной из основных токсичных форм A β [48]. Ранее было продемонстрировано, что β способен активировать микроглию, активация которой в основном связана с поддержанием и прогрессированием нейровоспаления [49]. Таким образом, вполне вероятно, что ингибирование наблюдаемых здесь нейротоксических эффектов опосредовано подавлением нейровоспаления.

3.3. RC подавляет индуцированные липополисахаридами воспалительные реакции в глиальных культурах крыс

Новые данные подтверждают концепцию о том, что персистирующее нейровоспаление является основным фактором нейродегенерации [1]. Действительно, высвобождение большого количества NO, генерируемого iNOS из активированной микроглии и астроцитов, может вступать в реакцию с ROS и продуцировать реактивные формы азота (RNS), вызывающие нейродегенерацию нейронов [50]. Чтобы исследовать способность RC регулировать нейровоспаление, мы сначала обработали смешанные глиальные культуры (астроциты и микроглия) LPS, хорошо известным мощным воспалительным агентом [51].Поскольку NO долгое время считался частью нейротоксического поражения, вызванного нейровоспалением, мы определили влияние RC на стимулированную LPS продукцию NO в глиальных клетках крыс. По сравнению с нестимулированными клетками секреция NO была заметно увеличена при обработке 2  мкг/мл ЛПС (рис. 3(а), ). Тем не менее, воздействие RC (0,5  мк M) в течение 30  мин до стимуляции LPS значительно ингибировало продукцию NO в смешанной глии (рис. 3(a), ). Никакого влияния на жизнеспособность клеток в глии после инкубации с РЦ и/или ЛПС не наблюдалось (данные не представлены).Затем влияние RC на индуцированную LPS экспрессию iNOS тестировали с помощью иммуноблоттинга. Как показано на рисунке 3(b), мы обнаружили, что предварительная обработка RC приводила к примерно 40% снижению экспрессии iNOS в стимулированных LPS глиальных клетках (дорожка 4). Поскольку NF- κ B имеет решающее значение для индуцированного ЛПС воспалительного ответа [52], мы дополнительно исследовали, опосредованы ли эффекты RC в смешанной глии через сигнальный путь NF- κ B. Как показано на рисунке 3(c), в глиальных клетках крыс в ответ на LPS наблюдалось заметное увеличение ядерной транслокации субъединицы р65 NF- κ B (дорожка 7), которая уменьшалась при предварительной обработке RC почти на 2.5-кратно (дорожка 8). В целом эти данные показывают, что RC существенно ингибирует NF- κ B-зависимые воспалительные реакции глии.

3.4. RC ингибирует активацию микроглии в микроглии крысы

Только недавно нейровоспаление появилось как патология болезни Альцгеймера, которая включает активацию микроглии [53]. ЛПС широко используется в качестве средства для индукции активации микроглии в моделях воспалительной нейродегенерации [54–56]. Действительно, было продемонстрировано, что индуцированное ЛПС нейровоспаление в головном мозге мышей APPswe Tg увеличивает внутриклеточное накопление белка-предшественника амилоида (APP) и A β 1–40/1–42 [57].Кроме того, системное воздействие ЛПС на мозг мыши стимулирует активацию микроглии, нейродегенерацию и снижение когнитивных функций [58, 59]. Кроме того, LPS-стимулированные микроглия или моноциты вызывали в нейронах увеличение экспрессии АРР и высвобождение продуктов его расщепления β -секретазой (sAPP β s), а также олигомеров A β [60, 61]. Поэтому мы использовали микроглию крыс, стимулированную LPS, для изучения влияния RC на опосредованную микроглией активацию микроглии.При стимуляции ЛПС продукция NO в микроглии крыс заметно повышалась по сравнению с контрольными клетками (рис. 4(а), ). Это увеличение уровней NO резко исчезло в клетках, предварительно обработанных RC (рис. 4(a), ). Не было обнаружено влияния на жизнеспособность клеток в микроглии крыс после обработки РЦ и/или ЛПС (данные не представлены). Кроме того, данные количественной ПЦР показали, что микроглия, обработанная ЛПС, проявляла повышенную экспрессию медиаторов воспаления, таких как Nos2 , Il1b , Ccl2 и Ccl5 , тогда как RC значительно снижал уровни мРНК этих факторов (рис. 4(b)). , 4(c), 4(d) и 4(e)).

Совсем недавно Norden et al. показали, что уровни экспрессии микроглиального маркера Iba-1 (ионизированная кальций-связывающая адапторная молекула-1) были повышены у мышей, зараженных LPS [62]. Точно так же в настоящем исследовании LPS-индуцированное увеличение экспрессии гена Iba1 также наблюдалось в микроглии крыс (рис. 4(f), ). Однако эффект значительно подавлялся при лечении RC (рис. 4(f), ). Это открытие согласуется с хорошо известным фактом, что Iba-1 сверхэкспрессируется в активированной микроглии во время нейровоспалительной реакции [63].В целом, наши данные предоставили доказательства того, что в активированной микроглии RC оказывает благотворное влияние, нацеливая iNOS на продукцию нитритов, а также модулируя уровни экспрессии цитокинов.

3.5. RC снижает продукцию IL-6 и TNF-
α в LPS-активированной микроглии BV-2

Для дальнейшего изучения аспекта нейровоспаления в качестве альтернативной модельной системы для первичной культуры микроглии использовали клеточную линию мышиной микроглии BV-2 [64]. ]. Модель активированного BV-2 часто используется для оценки эффективности и действенности иммуномодулирующих агентов в отношении эндотоксического образования NO, IL-6, TNF- α , IL-1 β , CCL-2 или НАДФН-оксидазы. к нейродегенеративному повреждению ЦНС [65, 66].Следовательно, мы исследовали, будет ли RC предотвращать продукцию цитокинов после активации LPS микроглии BV-2. Анализ ELISA клеток BV-2 показал, что RC ослаблял индуцированную LPS продукцию IL-6 и TNF- α (рис. 5(a) и 5(b)), оба из которых, как известно, способствуют аутокринной передаче сигналов в микроглии. Снижение IL-6 и TNF- α с помощью RC не было результатом цитотоксичности, что было подтверждено анализом МТТ (фиг. 5(c)). Учитывая, что как IL-6, так и TNF- α могут поставить под угрозу выживаемость нейронов [21], эти результаты повышают вероятность того, что RC могут защищать популяции нейронов, проявляющие повышенную уязвимость к апоптотической гибели, вызванной воспалением, путем ограничения продукции эти нейротоксические факторы хронически активированной микроглией.

3.6. RC Уменьшает секрецию IL-6 и TNF-
α из A β — и IFN- γ -Activated BV-2 Microglia

Многочисленные исследования показывают, что индуцированное цитокинами нейровоспаление способствует клиническому прогрессированию БА [67, 68]. Хотя трудно установить степень секреции цитокинов, которая происходит непосредственно в головном мозге, добавление фибриллярных форм A β 25–35 или IFN- γ стимулирует секрецию цитокинов культивируемыми макрофагами и микроглией [10]. 69, 70].Таким образом, мы исследовали эффекты RC на микроглию BV-2, стимулированную A β и IFN- γ . Как показано на рисунке 6(а), уровень IL-6 был повышен в микроглии, подвергшейся воздействию 20  мк M A β или 100 мкг/мл IFN- γ в течение 48 часов (), в то время как предварительная обработка RC (0,125–0,5 мк М) значительно препятствовали продукции ИЛ-6. Добавление A β вызывало небольшую, но незначительную продукцию TNF- α по сравнению с контрольными клетками, что аналогично результатам, полученным Couch и коллегами [71].Однако обработка RC значительно снижала секрецию TNF- α из клеток BV-2, инкубированных с A β или IFN- γ (фиг. 6(b)) без наблюдаемой цитотоксичности (данные не показаны).

Помимо хемоаттрактантной функции по привлечению моноцитов и макрофагов в мозг, CCL-5 и CCL-2 оказывают модулирующее действие на активированную микроглию [72, 73]. Следовательно, влияние RC на секрецию CCL-5 и CCL-2 также тестировали на микроглии BV-2, обработанной A β или IFN- γ в течение 24 часов.Мы обнаружили, что лечение RC показало тенденцию к подавлению продукции CCL-5 в микроглии BV-2, подвергнутой воздействию A β , но не IFN- γ (рис. 6(c)). Предварительная обработка клеток BV-2 0,5  мкМ M RC снижала уровни CCL-2, индуцированные A β или IFN- γ (рис. 7(a)). Это ингибирование цитокинов не было связано с цитотоксичностью, как было определено с помощью анализа высвобождения ЛДГ (фиг. 7(b)). В целом эти данные позволяют предположить, что RC оказывает ингибирующее действие на секрецию медиаторов воспаления, включая IL-6, TNF- α и CCL-2 в клетках BV-2.В соответствии с нашими выводами Chang et al. [34] сообщили, что РК, использованные в их исследовании, ингибировали мРНК IL-1 β , IL-6 и TNF- α в образцах спинномозговой жидкости крыс с субарахноидальным кровоизлиянием, в то время как подавление LPS-вызванного TNF- Секреция α из мышиных макрофагов RAW264.7 с РЦ была обнаружена Tewtrakul et al. [33] Поскольку все эти цитокины являются генами, управляемыми NF- κ B, мы дополнительно исследовали пути, модифицированные RC.

3.7. RC отменяет активацию NF-
κ B и ERK в A β — или IFN- γ -стимулированной микроглии

Фактор транскрипции NF- κ B является критическим регулятором иммунных и воспалительных реакций [52]. ]. Многочисленные данные свидетельствуют о том, что активация NF- κ B в ЦНС запускает многоклеточные реакции и трансактивацию генов, тесно связанные с инициацией и прогрессированием нейродегенеративных заболеваний. Различные эндогенные и экзогенные стимулы активируют NF- κ B, усиливая трансактивацию воспалительных молекул и продукцию свободных радикалов в глиальных клетках [74].Чтобы установить, снижает ли RC продукцию воспалительных цитокинов через путь NF- κ B, мы проверили влияние RC на субъединицу p65 NF- κ B. Микроглию BV-2 предварительно обрабатывали RC в течение 4 часов до к инкубации с 20  мк МА β или 100 мкг/мл ИФН- γ в течение 3 ч. Как показано на рисунке 8(a), A β или IFN- γ приводили к более высокому фосфорилированию субъединицы р65 (дорожки 4 и 7) по сравнению с контрольным аналогом (дорожка 1).С другой стороны, RC при 0,5 и 1  мк М снижал фосфорилирование A β — или IFN- γ -активируемого NF- κ B p65 (рис. 8(a), дорожки 5, 6, 8, и 9).

Предыдущие исследования показали, что ERK регулирует NF- κ B-зависимую транскрипцию и играет роль в нейровоспалении и БА [75]. Чтобы определить возможное влияние RC на активность ERK, мы предварительно обработали микроглию BV-2 RC (0,5 и 1  мк М) в течение 4 часов, а затем 20  мк мкА β или 100 мкг/мл IFN- Стимуляция γ в течение 3 часов.Наши результаты показали, что фосфорилирование ERK было значительно повышено в клетках BV-2, активированных A β или IFN- γ (рис. 8(b), дорожки 4 и 7), тогда как RC снижал активацию ERK (рис. 8( б), дорожки 5, 6, 8 и 9). Взятые вместе, наши результаты показывают, что RC нацелен на сигнальные пути NF- κ B и ERK и впоследствии отменяет экспрессию IL-6, TNF- α и CCL-2 в микроглии BV-2. В соответствии с потенциальными терапевтическими последствиями соединений, которые ослабляют передачу сигналов NF- κ B [76] или ERK [77], предполагается, что нейротоксичность, опосредованная микроглией LPS, A β и IFN- γ , вероятно, улучшается при РК за счет подавления NF- κ B- и ERK-опосредованных путей.

3.8. RC уменьшает токсическое воздействие кондиционированных сред из микроглии, обработанной A
β , на нейроны гиппокампа

В предыдущих отчетах указывалось, что активированная микроглия является важным медиатором нейротоксичности, индуцированной A β , посредством секреции токсических факторов, включая ROS, NO, и цитокины при нейровоспалении [78, 79]. Кроме того, фибриллы A β 25–35 оказывают цитотоксическое действие на нейроны и стимулируют микроглию к выработке нейротоксинов в микроглии крыс [23, 80, 81].Соответственно, мы оценили влияние RC на создание предположительно токсичных кондиционированных сред, полученных из микроглии крысы, обработанной фибриллами A β 25–35 . Как показано на рисунке 9, кондиционированные среды, полученные из микроглии, подвергнутой воздействию 5  мк M A β в течение 24 часов, снижали иммунореактивность Tau на 80% в нейронах гиппокампа (рис. 9(a) и 9(b), ), а также уменьшали длина аксона на 75% по сравнению с контролем (рис. 9(в), ). Напротив, кондиционированные среды, полученные из микроглии, предварительно обработанной 0.5  мк M RC с последующей 24-часовой инкубацией A β восстановила целостность нейронов, о чем свидетельствует повышенная иммунореактивность тау-белка и рост аксонов по сравнению с обработкой A β (рис. 9(a), 9(b) и 9(c). )). Эти наблюдения показывают, что RC способен ослаблять нейротоксичность, опосредованную микроглией. Наряду с нашими неопубликованными данными, показывающими, что A β 25–35 увеличивает экспрессию медиаторов воспаления, таких как IL-6, TNF- α , IL-1 β , CCL-2 и CCL-5 в в культуре нейронов гиппокампа крысы предполагается, что RC может уменьшать повреждение нейронов, вызванное микроглиальными кондиционированными средами, путем подавления A β 25–35 -индуцированного нейровоспаления.Однако точные механизмы еще предстоит выяснить.

Повышенная продукция фибрилл A β может активировать микроглию через различные рецепторы, которые участвуют в распознавании, интернализации и клиренсе A β , включая CD14, CD36, CD47, α 6 β 1 интегрин, класс Рецептор-мусорщик, рецептор конечных продуктов расширенного гликозилирования (RAGE) и толл-подобные рецепторы (TLR) [1]. Связывание A β , например, с RAGE приводит к продукции воспалительных цитокинов и снижает поглощение A β культивируемой микроглией [82, 83] и трансгенными мышами, экспрессирующими мутантный APP человека [84].Помимо продукции медиаторов воспаления при связывании A β с различными рецепторами микроглии, было обнаружено, что микроглия может очищать A β посредством рецептор-опосредованного фагоцитоза и деградации in vitro . Действительно, микроглия обладает механизмом деградации патогенно более релевантных видов A β с помощью внеклеточных протеаз, таких как неприлизин, инсулин-деградирующий фермент (IDE) и матриксные металлопротеиназы [85]. Принимая во внимание функцию RC в подавлении активатора рецептора лиганда ядерного фактора- κ B- (RANKL-), стимулируемого остеокластогенезом [35] и ингибировании АТФ-связывающих кассетных переносчиков (переносчиков ABC) в клетках рака молочной железы [86], Заманчиво предположить, что RC сдерживает нейротоксичность A β , вероятно, за счет опосредованного микроглией клиренса A β или воспалительных реакций посредством воздействия на рецепторы, мембранные белки или ферменты деградации, хотя их точные механизмы взаимодействия еще предстоит определить.

4. Выводы

Подходы к мишени A β с помощью пассивных антител или ингибирования γ -секретазы пока не принесли существенных клинических преимуществ, контролируя активацию микроглии, и вызванное этим нейровоспаление стало новой стратегией для разработка лекарств от БА. Здесь мы сообщаем, что RC наделен нейропротекторной ролью в процессах, которые, возможно, влияют на активацию микроглии и нейровоспаление. В частности, RC предотвращает цитотоксичность и усиливает рост нейритов в нейронах, обработанных A β .В ответ на LPS RC ингибирует секрецию NO и воспалительные реакции в первичной глии крыс. Аналогично, RC регулирует стимулируемую LPS, A β или IFN- γ гиперпродукцию воспалительных цитокинов в микроглии BV-2. Следует отметить, что активация NF- κ B и ERK подавлялась в клетках BV-2, подвергшихся воздействию A β и IFN- γ . Интересно, что RC частично защищает нейроны от A β -стимулируемой микроглией обусловленной средой токсичности. В целом, наши результаты указывают на то, что RC оказывает сильное противовоспалительное и нейропротекторное действие, вероятно, через сигнальные пути NF- κ B и ERK, как показано на рисунке 10, которые представляют собой новую терапевтическую меру для AD.Насколько нам известно, это самое первое свидетельство противовоспалительного действия RC в микроглии. Ввиду того, что недавно предложенные антимикроглиальные агенты, нацеленные на провоспалительный фенотип, были бы полезны при БА [87], необходимы дальнейшие исследования для определения механизмов, с помощью которых РЦ регулирует нейротоксичность, связанную с микроглиальным нейровоспалением, и точных функций РЦ в патогенезе БА. ОБЪЯВЛЕНИЕ. Это может иметь терапевтическое значение в перспективах применения РК для замедления или предотвращения патологии, связанной с БА, при подходе на основе микроглии [8].По этим причинам мы продолжаем изучать и исследовать эти механистические вопросы в нашей лаборатории. Соответственно, потенциал RC в профилактике или лечении болезни Альцгеймера будет изучаться в будущем на животных моделях.


Сокращения
9031 7 9031 8 MTT:
β : амилоид β пептид
АВС: АТФ-связывающего кассетного
АД: Болезнь Альцгеймера
ANOVA: дисперсионный анализ
APP: амилоидного белка-предшественника
БСА: бычьего сывороточного альбумина
CCD: прибор с зарядовой связью
CCL-2: хемокин (C-C MOTIF) ЛИГАНД 2 / MCP-1
CCL-5: CCL-5: CCL-5: CCL-5: CCL-5: CCL-5: Heamokine (C-C Motif) Лиганд 5 / Rantes
CNS: центральная нервная система
DAPI: 4, 6-диамидино-2-фенилиндол
ДМСО: Диметилсульфоксид
ECL: Усиленная хемилюминесценция
ИФА: иммуноферментный анализ
ЭРК: внеклеточной регулируемой киназы
GFAP: глиального фибриллярного кислого белка
HBSS: сбалансированный солевой раствор Хэнка
HRP: HRP: Hraperadish Peroxidase
IBA-1: IOnized адаптерный адаптер кальция 1
IFN- γ : интерферон- γ
IL-1 β : Интерлейкин-1 β
ИЛ-6: интерлейкин-6
иОАС: Индуцибельная синтазы оксида азота
ЛДГ: лактатдегидрогеназы
ЛПС: Липополисахарид
МЕМ: Модифицированная среда Игла
3- (4,5-диметилтиазол-2-ил) -2,5-дифенилтетразолий Бромид
NF- κ B: Ядерный фактор Kappa B
NGS: Нормальные козья сыворотка
NO: оксид Азотных
PBS: фосфатно-солевой буфер
ПФ: параформальдегида
ФМСФ: фенилметилсульфонилфторид
КПЦРА: Количественная полимеразная цепная реакция
RIPA: Радиоиммунопреципитация
RPMI: Мемориальный институт Roswell Park 9032 3
RNS: RN Трис-буферный раствор
TLRs: Toll-подобные рецепторы
TNF- α : Фактор некроза опухоли-

4α 90.

Конфликт интересов

Авторы заявляют об отсутствии конфликта интересов.

Вклад авторов

Ming-Der Perng и Shu-Fang Wen участвуют в разработке концепции и дизайна. Кай-Ан Чуанг, Минг-Хан Ли, Ни-Сюань Линь, Чжи-Сюань Чанг, И-Хуан Лу, Минг-Дер Пернг и Шу-Фан Вэнь работали над сбором данных. Кай-Ан Чуанг, Минг-Хан Ли, Минг-Дер Пернг и Шу-Фанг Вен проанализировали и интерпретировали данные. Минг-Дер Пернг и Шу-Фан Вэнь написали рукопись.Кай-Ан Чуанг, Мин-Хан Ли, Ни-Сюань Линь, Чжи-Сюань Чанг, И-Хуан Лу, И-Хонг Пан, Томоя Такахаши, Минг-Дер Пернг и Шу-Фанг Вэнь одобрили окончательную версию рукописи. . Кай-Ан Чуанг и Минг-Хан Ли внесли равный вклад в эту работу.

Благодарности

Авторы выражают благодарность Куан-Джен Чену за техническую помощь в области статистики. Это исследование было поддержано грантом Министерства экономики (№ 106-EC-17-A-22-0318) для лабораторий исследований биомедицинских технологий и устройств, грантом Министерства науки и технологий (MOST) 104-2311-B- 007-002 для Колледжа наук о жизни, а НПА финансирует Центр исследований и разработок ARSOA.

ИЖМС | Октябрь-2 2020 — Обзор статей

Несколько исследований показали важность ионов цинка для мужской фертильности. Здесь мы описываем свойства, роли и клеточные механизмы действия Zn 2+ в сперматозоидах, уделяя особое внимание его участию в подвижности сперматозоидов, капацитации и акросомальном экзоцитозе, трех функциях, которые имеют решающее значение для успешного оплодотворения. Также описано влияние добавок цинка на вспомогательные методы оплодотворения. Влияние цинка на подвижность сперматозоидов было исследовано у многих видов позвоночных и беспозвоночных.Сообщалось, что Zn 2+ в семенной плазме человека снижает подвижность сперматозоидов, а удаление Zn 2+ повышает подвижность. Уменьшение внутриклеточной концентрации Zn 2+ во время эпидидимального транзита позволяет развить прогрессивную подвижность и последующую гиперактивированную подвижность во время капацитации сперматозоидов. Внеклеточный Zn 2+ влияет на внутриклеточные сигнальные пути посредством взаимодействия с чувствительным рецептором Zn 2+ (ZnR), также называемым GPR39.Этот рецептор был обнаружен в хвосте сперматозоида и акросоме, что свидетельствует о возможном участии Zn 2+ в подвижности сперматозоидов и акросомальном экзоцитозе. Наши исследования показали, что Zn 2+ стимулирует акросомальный экзоцитоз бычьих сперматозоидов, а также гиперактивированную подвижность сперматозоидов человека, оба опосредуются GPR39. Zn 2+ связывается и активирует GPR39, который активирует трансмембранную аденилатциклазу (tmAC), чтобы катализировать продукцию цАМФ. NHE (Na + /H + -обменник) активируется цАМФ, что приводит к повышению pHi и активации специфического для спермы канала Ca 2+ CatSper, что приводит к увеличению [Ca 2+ ] i , который вместе с HCO 3 активирует растворимую аденилатциклазу (sAC).Увеличение [цАМФ] i активирует протеинкиназу А (PKA), за которой следует активация каскада Src-рецептор эпидермального фактора роста-Pфосфолипаза C (Src-EGFR-PLC), в результате чего образуется инозитолтрифосфат (IP 3 ). ) продукция, которая мобилизует Ca 2+ из акросомы, вызывая дальнейшее увеличение [Ca 2+ ] i и развитие гиперактивированной подвижности. PKA также активирует фосфолипазу D1 (PLD1), что приводит к образованию F-актина во время капацитации.Перед акросомальным экзоцитозом PLC индуцирует гидролиз фосфадилинозитол-4,5-бисфосфата (PIP 2 ), что приводит к высвобождению актин-разъединяющего белка гельзолина в цитозоль, который активируется Ca 2+ , что приводит к Распад F-актина и возникновение акросомального экзоцитоза. Полная статья

Что лучше — глицин или афобазол?

На данный момент научное медицинское сообщество изобрело множество надежных седативных средств, наиболее популярными являются глицин и афобазол.Несмотря на одинаковые показания, они по-разному действуют на организм.

Что лучше — глицин или афобазол?

Глицин

В медицине глицин — мягкое успокаивающее средство, обладающее способностью не только успокаивать, но и повышать умственную работоспособность, улучшать сон. «Глицин» улучшает такие психические функции, как память, внимание и мышление.

Поскольку в биохимии глицин является жизненно важной аминокислотой, входящей во все нервные волокна и компонентом головного мозга, противопоказанием к его применению является только гиперчувствительность.Глицин можно использовать во время беременности, кормления грудью и за рулем.

Аминокислоты являются жизненно важными веществами, из которых состоят белки.

Афобазол

«Афобазол», в отличие от «Глицина», является химическим препаратом. Повышает биоэнергетический потенциал нервных клеток и защищает их от повреждений. Этот препарат лучше, чем «Глицин», справляется со стрессовыми состояниями, устраняет соматические проявления тревоги (потливость, тики, головокружение, кардиальные и респираторные проявления страха и тревоги).На самом деле «Афобазол» — это не успокоительное, а транквилизатор, антидепрессант.

В отличие от «Глицина», «Афобазол» практически не влияет на память, внимание и мышление, но нормализует сон (также не вызывает сонливости в дневное время). Поэтому его также можно принимать при управлении транспортными средствами.

Что выбрать

При беременности и кормлении грудью, конечно же, лучше выбрать «Глицин», так как, в отличие от «Афобазола», это аминокислота – естественный компонент мозга, а не химический препарат.

В остальных случаях нужно ориентироваться на свое состояние. В ситуациях, требующих повышенной концентрации внимания и памяти, улучшения мышления, но менее травмирующих психику, «Глицин» справится лучше. Его прием полезен подросткам, сдающим экзамены; люди готовятся к важному собеседованию, важному событию; школьников и студентов, отстающих по каким-либо предметам.

Если нет необходимости улучшать эти психические функции, но имеются хронические или острые травмирующие психику ситуации, целесообразно выбрать Афобазол.Такие ситуации могут быть постоянным чувством беспокойства, плаксивости, раздражительности, бессонницы, страхов, потери близких.

Персен — антидепрессант, эффективное седативное средство, нормализующее сон, настроение и социальную адаптацию.

Помимо «Глицина» и «Афобозола», отличными успокаивающими средствами могут быть «Персен» и «Грандаксин».

Грандаксин — транквилизатор умеренной возбуждающей активности, улучшающий психомоторные и интеллектуальные функции.

Их также можно использовать во время вождения.

Афобазол — средство от стресса

Стресс, тревога и депрессия Одним из лучших препаратов считается Афобазол. Отличительная особенность лекарства в том, что он не оказывает выраженного седативного действия, не влияет на активную функцию головного мозга. Даже при длительном курсе Афобазол не вызывает привыкания, снимает тревогу и стресс, оказывает стимулирующее действие на организм.

Афобазол, в первую очередь, успокаивающее, а не обезболивающее средство, поэтому при головных болях и головокружениях он помогает только в том случае, если они вызваны сильным стрессом, постоянным беспокойством, эмоциональным напряжением, паническими атаками.Во всех остальных случаях, когда причиной болей или дискомфорта является травма, воспаление, спазм и так далее, он совершенно бесполезен.

Однако врачи часто назначают Афобазол с другими препаратами при наличии у больного объективных причин болей, тяжелой стрессовой ситуации — проблемах в семье или на работе, склонности к тревожности, панических атаках как осложнении вегето-сосудистой дистонии и других неприятных моментах. это может помешать лечению и усилить головную боль.

Головокружение Афобазол помогает только тогда, когда это связано с нервной системой — больной чего-то боится, любит, хотел бы избежать, а головокружение является психосоматической реакцией на стресс.

Действие афобазола снижает дискомфорт и раздражительность, устраняет последствия стресса и регулярного нервного напряжения. Результатом курса является улучшение психоэмоционального и физического состояния.

Нормализация психических состояний уменьшает соматические и когнитивные расстройства, в том числе мышечные, дыхательные и сердечные спазмы.

Курс приема препарата значительно снижает частоту возникновения различных нарушений вегетативной системы, в том числе сухости, повышенной потливости и головных болей.

Афобазол рекомендуется принимать для улучшения памяти во время сессии и экзаменов школьников. Принимать препарат лучше принимать, что усилит его действие. Оптимально начинать прием лекарства за 4 недели до экзаменов. Эффект сохраняется около двух недель после курса.

Чаще всего Афобазол назначают астеникам, страдающим мнительностью и эмоциональной неустойчивостью.

Имеет минимальное количество побочных эффектов, но разрешается принимать только с 18 лет. Беременным женщинам, женщинам в период лактации большинство препаратов на основе афобазола противопоказано.

Препарат выпускается только в форме таблеток, хорошо всасывается и быстро полностью выводится из организма, что делает передозировку лекарством практически невозможной. Афобазол начинает выводиться из организма примерно через 45 минут после полного рассасывания.

Афобазол выпускается в таблетках по 10 или 25 штук в блистерах, по 30, 50 или 100 таблеток в пластиковой банке.

Показания к применению

  • Необъяснимые приступы тревоги и стресса, приступы неврастении и нервных расстройств.
  • Соматические расстройства: астма, волчанка,

    Способ применения и дозы

    Афобазол назначают внутрь, после приема пищи. Дозировку должен подбирать лечащий врач в зависимости от физиологического и эмоционального состояния больного.

    Суточная доза не должна превышать 30 мг. Однако при тяжелых нарушениях нервной системы доза может быть увеличена до 60 мг в сутки.

    Лечение может длиться от 2 недель до 3 месяцев, в зависимости от состояния пациента.Также врач может назначить повторный курс через 1-2 месяца после последнего приема препарата.

    Побочные эффекты

    Афобазол может вызывать аллергические реакции, в том числе крапивницу.

    Вы можете испытывать тошноту, рвоту и расстройство желудка. В редких случаях возникает диарея, запор или диарея.

    Противопоказания

    Непереносимость основных компонентов драже, в том числе лактозы.

    Препарат противопоказан детям и подросткам до 18 лет, беременным женщинам и кормящим матерям.При беременности Афобазол не назначается даже в самых тяжелых случаях нервных расстройств, поскольку его компоненты отрицательно влияют на развитие плода, особенно на ранних и поздних сроках.

    А поскольку афобазол выделяется с грудным молоком, при назначении кормящей женщине предполагается прекращение кормления ребенка грудным молоком на период приема препарата. Возобновление грудного вскармливания допустимо только через 2 недели после окончания курса.

    Взаимодействие с другими лекарственными средствами

    Афобазол оказывает наиболее выраженное действие при одновременном применении с ноотропами и анксиолитиками, в т.ч.грамм. диазепам. Назначать курс и дозы должен врач.

    Кроме того, препарат усиливает противосудорожное действие соответствующих препаратов и не влияет на действие этанола. Однако настоятельно рекомендуется воздерживаться от приема алкоголя во время лечения афобазолом.

    Передозировка

    Существенная передозировка этим препаратом практически невозможна, однако прецеденты имеют место быть. При чрезмерном применении афобазола возникает повышенная сонливость, появляется спутанность мыслей и речи.Возможен обморок.

    Препарат, выводящий Афобазол из организма, не предназначен в качестве вспомогательного средства при приеме бензоата натрия-кофеина двадцатипроцентного раствора по 1 мл 2 раза в сутки подкожно.

    Цена афобазола

    Как бы ни был эффективен Афобазол, цена на успокаивающее средство не слишком дешевая. За упаковку таблеток из 60 штук придется заплатить не менее 350 рублей, а упаковки меньшего размера содержат меньше, чем нужно на курс, и стоят от 200 рублей.

    отзывов

    «Вообще-то, Афобазол — это не успокаивающее, а успокаивающее средство.Так что тем, кто хочет остепениться, лучше пить валериану или пустырник. Кстати, отлично работает ВСД-шник, просто на ура справляющийся с самыми неприятными симптомами. А еще помогает забыть о стрессе и нервах. Вот только при тяжелой депрессии он не помощник, так что тут может помочь только врач. В общем, я считаю, что это отличный препарат, тем более, что цена на афобазол нормальная.»

    «Во время сеансов. Реально улучшает память, и сонливость, вечный спутник зачетов и экзаменов как рука стреляет.И самое главное, достаточно дешевое средство: 200 рублей за 50 таблеток — это воровство! И держится на протяжении всего сеанса, и не вызывает привыкания. Всем ученикам однозначно рекомендую!»

    «Никаких побочных эффектов, никакого беспокойства и стресса я забыла. Стала спокойной и уверенной, перестала волноваться по мелочам. Самое приятное, что вечные мешки под глазами ушли! Помолодела на 10 лет. Так что всем дамам крайне рекомендуется пить Афобазол, конечно, если он вам нужен.»

    «Столько рекламы, а эффект… очень странный. Таблетка, как написано в инструкции, продержалась всего три дня.

Написать ответ

Ваш адрес email не будет опубликован.