Низорал от молочницы: Кто пил Низорал таблетки от молочницы???? — 5 ответов

Содержание

Низорал от молочницы в таблетках и иных формах

Опубликовано: 21 июл 2014, 10:48

Низорал – противогрибковый лекарственный препарат широкого спектра действия. Он в индивидуальных случаях применяется при лечении молочницы, которая вызывается грибком рода Кандида. Основным действующим веществом средства является кетоконазол. Механизм действия заключается в нарушении обмена веществ на уровне клеток возбудителя и разрушении его клеточных мембран.

Формы выпуска

Низорал при лечении молочницы у женщин, мужчин и реже детей, может применяться в формах для местного наружного применения и общего внутреннего действия. К первому типу относятся: мази, свечи, кремы, а ко второму – таблетки. Выбор лекарственной формы зависит от степени тяжести заболевания. При этом местные средства действуют на конкретный участок поражения, а общие с током крови разносятся по организму, охватывая все области локализации грибка. Для эффективного избавления от заболевания рекомендуется комплексное лечение, сочетающее использование обоих типов.

Способы применения

Лечение кандидоза местным способом у женщин проводится при помощи вагинальных свечей Низорал. Один раз в сутки перед сном свеча вводится во влагалище, слизистая которого является областью поражения грибком. Продолжительность курса составляет до 14 дней.

Препарат в виде мазей и кремов чаще всего используется для лечения молочницы у мужчин, местом локализации которой, является головка полового члена, а также крайняя плоть. В этом случае на пораженный участок наносится препарат тонким слоем 2-3 раза в сутки. Курс лечения составляет от 5-14 дней.

Применение таблеток Низорал от молочницы отдельно или в комплексе с вышеперечисленными местными формами препарата, позволяет справиться с любой тяжестью заболевания с большим успехом. Их принимают во время еды, запивая стаканом воды. Дозировка может составлять 200 и 400 мг в зависимости от сложности заболевания и назначается врачом. Продолжительность приема также может быть индивидуальной, но не менее 5 дней.

Противопоказания

Перед применением данного препарата от молочницы необходимо проконсультироваться с врачом, т. к. существует ряд противопоказаний. К их числу относятся следующие:

  • заболевания печени, а также почек;
  • аллергические реакции на компоненты препарата;
  • период лактации и беременность (нельзя таблетки).

Не разрешается принимать таблетки Низорал детям младше трех лет.

Побочные эффекты

К основным побочным эффектам местных препаратов Низорал от молочницы относятся:

  • зуд и жжение пораженных участков;
  • аллергические реакции.

В случае применения таблеток могут возникнуть следующие проявления поюочных эффектов:

  • нарушение сна;
  • нарушение цикла менструации;
  • головокружение;
  • ухудшение свертываемости крови;
  • головные боли;
  • нарушения работы пищеварительных органов.

Лечение молочницы с помощью таблеток Низорал проводится наряду с контролем анализов крови.

Надоела молочница?

МОНАСТЫРСКИЙ ЧАЙ — лучшее народное средство от молочницы! Ес его применять, то…

загрузка…

загрузка…

загрузка…

Интересные материалы по этой теме!

21 июл 2014, 09:11Помогает ли лаванда от молочницы?
Целебные свойства лаванды широко известны среди травников и часто применяются в фито терапии для исцеления различных недугов…. 21 июл 2014, 10:42Противозачаточные средства
В переводе с латинского языка слово «контрацепция (contraceptio)» означает исключение, а средства контрацепции — способы и методы…

загрузка…

загрузка…

загрузка…

загрузка…

Отзывы и комментарии

Оставить отзыв или комментарий

Кандидоз у мужчин — диагностика заболевания

Препараты от молочницы

Молочница возникает на фоне заражения половых органов грибками рода Candida. Лекарства, применяемые при лечении заболевания, за счет укрепления местного и общего иммунитета подавляют активность патогенной микрофлоры и предупреждают рецидивы. Терапия проводится одновременно у женщин и мужчин, независимо от того, у кого изначально была обнаружена грибковая инфекция.

Для лечения молочницы существует масса фармакологических средств системного и направленного действия. Новейшие препараты могут быть использованы не только в лечебных, но и в профилактических целях: они способствуют нормализации количества грибов Кандида в микрофлоре половых органов и защищают организм от рецидивов заболевания.

В стандартную схему лечения включают как противогрибковые средства, так и препараты для укрепления иммунитета. А для закрепления результатов медикаментозной терапии рекомендуют пересмотреть рацион и образ жизни и контролировать приём антибиотиков, провоцирующих бактериальный дисбаланс.

Формы и группы препаратов от молочницы

Все лекарства против молочницы делят на местные и системные.

Местные

К ним относятся вагинальные свечи, таблетки, растворы, мази:

  • действуют непосредственно на очаг скопления грибка;
  • быстро устраняют симптомы кандидоза;
  • не вызывают побочные реакции.

Срабатывают только на первичной стадии инфекции, при этом не всегда гарантируют полное излечение.

Системные

В эту группу входят противогрибковые препараты для перорального приёма. В отличие от местных, они всасываются в кровь и оказывают общее действие. Учитывая, что грибы Кандида способны размножаться на слизистых нескольких органов, сосуществуют с другими условно-патогенными и патогенными бактериями (хламидиями, уреаплазмой, микоплазмой, трихомонадой) лечение медикаментами с системным действием более эффективно и рационально.

Что входит в обследование при молочнице

Таблетки

В комплексной терапии основное лечебное действие оказывают таблетки, так как уничтожают грибок одновременно во всех очагах. Свечи и мази при такой тактике лечения выполняют вспомогательную роль, назначаются с целью купирования локальных воспалительных процессов.

В составе таблеток несколько активных веществ. Это даёт возможность повысить качество лечения даже при хронических формах заболевания. Наиболее популярные препараты – Низорал, Пимафуцин, Ирунин, Дифлюкан.

Свечи

С ликвидацией колоний грибка, воспалением влагалища при первичной молочнице отлично справляются вагинальные свечи, которые содержат противогрибковые компоненты.

Результат местного лечения проявляется уже после первого применения. Кроме того, у большинства женщин свечи не вызывают побочных реакций.

Недостаток вагинальных средств – невозможность использования при монотерапии. Если инфекция затяжная или хроническая, то свечи лишь дублируют основной системный препарат для усиления степени воздействия на грибок. Самые распространённые: Ливарол, Гино-Травоген Овулум – борются против смешанных инфекций, Клион-Д – не совместим с алкоголем.

Подробнее о лечении молочницы

Показания к назначению мазей – кандидамикоз различной локализации на слизистой половых органов. Некоторые кремообразные средства универсальны: используются для лечения целого ряда грибковых заболеваний, поражающих не только половые органы, но и кожу, ногти. Это совсем не значит, что все противогрибковые мази подходят для лечения молочницы. Например, популярные Ацикловир и Акридерм помогут справиться с поражениями кожи вирусом герпеса, но при кандидозе не назначаются.

Снять покраснение, зуд помогут мази Клотримазол, Пимафуцин, Леворин, Тридерм. Полностью вылечить молочницу они не способны, поэтому назначаются в комплексе с таблетками общего действия.

Лекарства от кандидоза для мужчин

Мужчинам обычно назначаются таблетированные препараты широкого спектра действия: Пимафуцин, Ороназол, Ирунин, Низорал. Некоторые из них, например, Флюкостат, обладают мощным противогрибковым эффектом – для уничтожения спор грибка достаточно одной таблетки.

Для укрепления иммунитета и восстановления количества лактобактерий в терапию включаются иммуномодуляторы и пробиотики.

Лекарства для лечения молочницы имеют противопоказания, поэтому принимать их бесконтрольно нельзя.

Средства от молочницы для женщин

При невыраженной симптоматике кандидоза у женщин применяются местные препараты, например, Мирамистин.

Для комплексной терапии подбираются лекарства, угнетающие грибок, независимо от локализации очага. Они разделены на несколько групп:

  • триазоловые антибиотики – Дифлюкан, Микосист;
  • полиеновые антибиотики – Леворин;
  • имидазолы – Клотримазол, Кетоконазол;
  • макролиды – Пимафуцин;
  • комбинированные – Полижинакс.

С точки зрения эффективности отлично зарекомендовал себя Дифлюкан – для блокировки процесса размножения грибка достаточно одной таблетки, Пимафуцин – недорогое, нейтральное противогрибковое средство (не вызывает аллергию), которое подходит почти всем пациенткам. Вагинальные суппозитории Пимафуцина назначаются беременным женщинам, в то время как Бетадин и Нистатин из-за высокой токсичности противопоказаны.

При хронической форме пациентке назначают:

  • Клотримазол – местно;
  • Флуконазол – противогрибковое средство широкого спектра действия;
  • Ирунин – синтетический антибиотик.

Штамм Candida быстро приспосабливается к действующему веществу, поэтому при рецидиве кандидоза, средство, которое помогло при первичных проявлениях заболевания, не будет эффективным.

Обратите внимание – подбором лекарств должен заниматься только врач, поскольку при составлении схемы лечения учитываются особенности взаимодействия препаратов и их классификация, основанная на фармакологических свойствах!

Где пройти консультацию по лечению молочницы

Самолечение при инфекциях половых органов недопустимо. Врачи Медицинского женского центра проводят консультации по лечению и профилактике бактериального вагиноза, в том числе, молочницы. В лаборатории центра вы можете сдать мазок на флору, бакпосев, ПЦР.

Кандидоз у мужчин — диагностика заболевания

Многие уверены, что кандидоз – это чисто женское заболевание, однако это не так. Болезнь может проявляться у обоих полов, только у мужчин кандидоз чаще всего проходит бессимптомно. Возникновение молочницы обусловлено размножением микроскопических дрожжеподобных грибов Кандида. В небольшом количестве они присутствуют в каждом организме, но при падении иммунитета и под воздействием многих других факторов их количество может увеличиться до визуального проявления.

Проявление кандидоза у сильного пола

Из-за особого строения мужского органа, а также при здоровом образе жизни, регулярной гигиене и культуре половых отношений кандидоз у сильного пола если и бывает, то протекает бессимптомно. При появлении симптоматики, больной может обнаружить:

  • ощущение болей при мочеиспускании, во время полового контакта;
  • появление покраснений на головке пениса и крайней нижней плоти, возможны отеки;
  • постоянное ощущение зуда и жжения;
  • творожистый налет на слизистой полового органа, ощущение кислого запаха.

Все это является поводом для обращения к специалисту. Возможно, молочница является только косвенным признаком другого заболевания.

Хронический кандидоз у мужчин

Если кандидоз перешел в хроническую стадию, то от него будет очень трудно излечиться. Он получает так называемый “иммунитет” к некоторым медицинским препаратам, а также проникает вглубь организма. Для лечения понадобиться пройти курс противогрибковых препаратов в виде таблеток.

Нужно отметить, что если кандидоз все же перешел в хроническую форму, то он может идти дополнением к более серьезным заболеваниям гормонального фона, проблем с иммунитетом или углеводным обменом. В этом случае необходимо полноценное и расширенное диагностирование.

Лечение кандидоза у мужчин

Для лечения кандидоза у мужчин необходимо сделать ряд анализов, чтобы понять общую картину. Если диагностировано заболевание, то обследуют также и партнершу. Как выглядит процесс лечения?

  • Используют необходимые противогрибковые препараты.
  • Повышают культуру личной гигиены.
  • Меняют свое питание, чтобы нормализовать работу желудочно-кишечного тракта.

Какие препараты применяют для лечения заболевания?

Чтобы преодолеть это заболевание, больному выписывают противогрибковые препараты. Они могут быть в виде мазей или таблеток, прием внутрь или наружное использование которых способно регулировать количество патогенных микроорганизмов.

Чаще всего используют препараты, в основе которых следующие вещества:

  • Миконазол. Бывает в виде спрея или крема. При нанесении он нарушает целостность различных патогенных микроорганизмов.
  • Кетоконазол. Представлен в виде кремов, спреев, таблеток. Уменьшение популяции грибов происходит за счет разрушительного воздействия на биосинтез некоторых компонентов клеточной мембраны грибов.
  • Эконазол. Бывает в виде кремов. Воздействует на липидную структуру мембраны грибков, обладая бактерицидным и фунгицидным способом.
  • Клотримазол. Представлен в виде кремов, мазей и растворов. Положительно воздействует на дрожжевые и плесневелые грибы, убивает грамотрицательные и грамположительные бактерии, дерматофиты.

Диагностирование и лечение заболевания

При появлении первых признаков молочницы, мужчине нужно обратиться к врачу-урологу. Именно он лечит это заболевание у сильного пола. Для установления диагноза следует сдать мазок на бактериоскопическое исследование и бакпосев. Дополнительно пациенту можно назначить тесты:

  • на наличие половых инфекций;
  • сдать анализ крови на сахар;
  • на реакцию Вассермана;
  • сдать общий анализ крови и мочи.

Если появление молочницы имеет причины (сахар, инфекция половых органов и т.д.), то проводят соответствующее лечение у узких специалистов. При обнаружении только одной молочницы, лечение симптоматическое местными препаратами.

Чтобы уменьшить риск возникновения кандидоза, необходимо придерживаться профилактических мер, а именно: соблюдать личную гигиену, исключить беспорядочные и незащищенные половые связи, делать регулярный самостоятельный осмотр половых органов на предмет различных изменений, поддерживать высокий уровень защитных функций организма. Будьте здоровы!

Острый панкреатит — почему начинается и как лечить

Обычно ферменты поджелудочной железы не активируются до достижения двенадцатиперстной кишки. Однако при определенных условиях эти ферменты активируются и разрушают клетки железы (как переваривание пищи). Поскольку поджелудочная железа не окружена четко определенной капсулой, воспаление может легко распространяться. Эта клиническая форма называется отечным панкреатитом.

Если воспалительный процесс не прекращается, он может привести к некрозу паренхимы (основной или специфической части органа). В этом случае патология известна как диффузный или локализованный некротизирующий панкреатит. Некроз иногда сопровождается кровотечением и железистой дисфункцией, в этом случае клиническое проявление называется геморрагическим панкреатитом.

Острый панкреатит

Острый панкреатит — это заболевание, которое возникает внезапно и обычно разрешается через несколько дней после лечения, хотя в некоторых редких случаях может угрожать жизни.

Причины

Этиология сложна и варьируется от случая к случаю. Заболевают чаще лица в возрасте 30 – 60 лет.

Этиологические причины:

  • Ситуации, которые вызывают рефлюкс желчи в поджелудочной железе;
  • Причины рефлюкса дуоденального сока в поджелудочную железу;
  • Обструкция протоков поджелудочной железы;
  • Травмы.
  • Ожирение;
  • Алкоголизм;
  • Диетические злоупотребления;
  • Желчные камни, инфекции желчных путей;
  • Хронические заболевания печени;
  • Диабет;
  • Язва двенадцатиперстной кишки;
  • Инфекционные заболевания (гепатит, тиф).

Симптомы

Типичные проявления: боль в верхней части живота, тошнота, рвота и лихорадка (37 – 38 градусов). Боль спонтанная и во время пальпации обычно ограничена верхней частью живота. Иногда пациента не беспокоят боли, но появляется вздутие живота, тошнота, лихорадка и тахикардия.

Боль внезапная, достигает максимальной интенсивности через несколько часов и сохраняется в течение как минимум 1-2 дней. Тошнота и рвота часто сопровождают боль в животе. Лихорадка, присутствующая в первые дни болезни, обычно сопровождается тахикардией.

Диагностика

Определение амилазы в сыворотке крови и в моче. Амилаза — это фермент, обнаруженный в слюне и поджелудочном соке, помогающий пищеварению.

Повышенная сывороточная амилаза быстро увеличивается в первые 12 часов после начала заболевания и сохраняется в течение 3-5 дней, после чего значения нормализуются. Мочевая амилаза увеличивается параллельно с амилазой сыворотки крови.

  • Определение липазы . Липаза — это фермент, который разрушает жиры. Повышенное содержание этого фермента появляется поздно и может сохраняться до 14 дней
  • Определение фосфолипазы (сложный и дорогостоящий метод). Фосфолипаза представляет собой фермент, который катализирует гидролиз фосфолипидов.
  • Определение трипсина в сыворотке . Трипсин — это фермент, который катализирует превращение пептидных соединений.
  • Лейкоцитоз — увеличение количества лейкоцитов в крови, признак острого воспалительного процесса.
  • Исследование функции печени. Метаболическая разведка — глюкоза, сывороточный кальций, электролиты крови, жидкости и баланс электролита, повышенная сывороточная мочевина.
  • Простая абдоминальная рентгенография — непроходимость непроходимости кишечника, изменения положения органов брюшной полости.
  • Рентгенография грудной клетки — левый ателектаз.
  • Ультразвук брюшной полости — увеличение размера поджелудочной железы из-за диффузного отека.
  • Компьютерная томография (КТ) — расширение пределов поджелудочной железы, искажений и размытых контуров.
  • Магниторезонансная томография (МРТ).

Лечение острого панкреатита

Острый панкреатит является одной из основных хирургических и терапевтических экстренных ситуаций. Лечение сложное, индивидуализированное для клинической формы и этиологии.

Консервативное лечение

Пациенты с легким острым панкреатитом принимаются в отделение гастроэнтерологии, пациенты с острым панкреатитом средней и тяжелой степени допускаются непосредственно в отделение интенсивной терапии для специализированного лечения и постоянного мониторинга.

Терапевтические методы, необходимые на первой фазе, связаны в различных комбинациях для достижения анальгезии, лечения шока и поли органной недостаточности, прекращения патогенетической цепи и предотвращения осложнений, особенно септических осложнений.

Хирургическое лечение

Экстренные операции у пациентов с клиническими признаками острого хирургического живота (ситуация, вызванная повреждением одного или нескольких органов брюшной полости в результате травмы или болезни, больной имеет сильную боль и часто находится в шоке) и неопределенный диагноз, неподдающийся или неопределенный острый панкреатит.

Средство от грибка и молочницы

Ключевые теги: мази для лечение грибка детям, мазь для уха против грибка, средство от грибка на ногтях ног медикаментозные.


Эффективные крема от грибка на ногах, мазь против грибка на ногтях, средство для удаления грибка hg, варанга средство от грибка отзывы цена, средство для удаления грибка hg.

Принцип действия

МИНЕРАЛЬНО-ЩЕЛОЧНАЯ КОМПОЗИЦИЯ пролонгированного действия на 100% уничтожает всех известных возбудителей грибка Устраняет зуд и дискомфорт уже после первого применения Через потовые железы стоп выводит из организма токсичную лимфу Устраняет натоптыши, мозоли и трещины, смягчает кожу Гарантированно избавляет от грибка. Рецидивы исключены Результат гарантирован с первого применения

Пимафуцин. Это популярное и эффективное лекарство отличается хорошей переносимостью, малой токсичностью и отсутствием аллергических реакций, поэтому разрешено для лечения молочницы во время беременности, лактации. Дешевые и эффективные свечи от молочницы, от инфекций у женщины и девушек. Не возникает устойчивость у грибка, поэтому нистатиновые свечи часто назначают при рецидивах молочницы и … Средств от молочницы много и в принципе все они помогают, но не на долго. Для себя открыла новое средство это Лактожиналь.


Официальный сайт Средство против грибка GLATTE

Состав

Свечи от молочницы — это наиболее удобный способ местной терапии кандидоза влагалища у женщин. … Эффективное средство при рецидивирующей … какой вид грибка присутствует в мазке.и именно … Как распознать и вылечить онихомикоз на ногах. Причины поражения и профилактика грибка ногтей. Быстрые и эффективные способы избавиться от недуга. 1/4/2016«Даже если вам посоветовала подруга лучшее средство от молочницы у женщин, отзывы врачей могут быть совсем другими, поэтому перед применением лучше получить консультацию специалиста.

Результаты клинических испытаний

Низорал от молочницы и грибка ногтей Низорал – деликатное средство от грибка, которое для некоторых стало просто панацеей в исцелении Средство от молочницы без рецепта Кроме медицинских препаратов для лечения молочницы , которые отпускаются лишь по рецепту врача, существуют и … Весомым его достоинством является то, что вводить его нужно однократно. Никогда не запутаюсь и не забуду следующий прием. Один раз ввела крем и избавилась от молочницы.

Мнение специалиста

Ежедневно с этой проблемой сталкиваются десятки тысяч людей. Своим пациентам я рекомендую щелочно-минеральную композицию Glatte с микрочастицами жемчуга. Я уже давно убедился в результативности средства: тут все элементарно просто, против науки не попрешь: грибы живут в кислой среде (например, пот), а в щелочной- погибают. Теперь регулярно получаю слова благодарности от пациентов, которых это средство спасло от грибка стопы и даже ногтя.

Низорал от молочницы и грибка ногтей. Низорал – деликатное средство от грибка, которое для некоторых стало просто панацеей в исцелении . Несмотря на то, что схему лечения и препараты назначает лечащий врач, лучше ознакомиться с самыми лучшими средствами от молочницы. Лучшее средство от молочницы Мне кажется, самое лучшее средство от молочницы это флюкостат. Он мне ее до конца вылечил и болезнь после этого не возвращалась больше.

Способ применения

1.Одно саше растворите в 2-3 литрах теплой (но не горячей!) воды 2.Опустите в ванночку ноги и расслабьтесь 3.Время приема ванночки может варьироваться от 20 минут до 2-х часов, в зависимости от степени поражения грибком 4.Во время процедуры приветствуется легкий массаж стопы щеткой или мочалкой 5.Наслаждайтесь здоровыми стопами без грибка!

Средство от молочницы без рецепта Кроме медицинских препаратов для лечения молочницы , которые отпускаются лишь по рецепту врача, существуют и такие, которые можно использовать без него. Весомым его достоинством является то, что вводить его нужно однократно. Никогда не запутаюсь и не забуду следующий прием. Один раз ввела крем и избавилась от молочницы. Какое недорогое средство от молочницы наиболее эффективно в лечении у мужчин? Ведь молочница у мужчин проявляется также, как и у женщин.

Как заказать?

Заполните форму для консультации и заказа Средство против грибка GLATTE. Оператор уточнит у вас все детали и мы отправим ваш заказ. Через 1-10 дней вы получите посылку и оплатите её при получении

11/26/2017«Когда нужны таблетки от молочницы. Грибки рода кандида могут поразить слизистую, кожные покровы, чаще всего обитают на половых органах и ротовой полости. Чтобы подобрать эффективные препараты от молочницы для мужчин и женщин, необходимо посетить врача и сдать нужные анализы, чтобы определить не только разновидность грибка, но и его … Средство от молочницы и грибка Флуконазол это номер 1 препарат от молочницы. А я его применяла несколько раз в жизни (и не только от молочницы) расскажу обо …

Средства для профилактики грибка стопы и ногтей, мазь от грибка члена, грибок на мошонке крем, мази на половой член от грибков, лучшее средства от грибка, мази для лечения грибка паха, термикон мазь при грибке ногтей.
Официальный сайт Средство против грибка GLATTE

Купить Средство против грибка GLATTE можно в таких странах как:


Россия, Беларусь, Казахстан, Киргизия, Молдова, Узбекистан, Украина, Эстония, Латвия, Литва, Болгария, Венгрия, Германия, Греция, Испания, Италия, Кипр, Португалия, Румыния, Франция, Хорватия, Чехия, Швейцария, Азербайджан , Армения ,Турция, Австрия, Сербия, Словакия, Словения, Польша


А у нас у всей семьи грибок, от меня заразились… Уже и не знал что делать, как посоветовали воспользоваться этим средством. Спасибо большое, помогло всем!)

Слышала про Glatte от подружки, которая в Америке живет. Ей там тоже доктор посоветовал. И фотки показывала до и после (не в блоге – мне лично). Так что, всем неверующим могу показать)

Извиняюсь, не заметила на сайте сначала информацию про наложенный платеж. Тогда все в порядке точно, если оплата при получении. Пойду, оформлю себе тоже заказ.

Кетоконазол: противогрибковый препарат, используемый для лечения кожных инфекций

Всегда следуйте инструкциям, прилагаемым к вашему лекарству, или совету врача.

Как долго и как часто вы используете кетоконазол, зависит от типа вашей проблемы с кожей.

Как часто использовать крем от эпидермофитии стоп, зуда и потливости

Наносить крем один или два раза в день на инфицированную кожу и окружающие участки. При микозах стоп необходимо регулярно использовать два раза в день.

Продолжайте использовать крем в течение 3 дней после исчезновения симптомов, чтобы инфекция не вернулась.

Как часто использовать шампунь или крем при себорейном дерматите

Используйте шампунь два раза в неделю в течение 2–4 недель, пока симптомы не исчезнут. Затем используйте его один раз в 1-2 недели, чтобы они не возвращались.

В качестве альтернативы вы можете использовать крем один или два раза в день в течение 2–4 недель, а затем использовать шампунь один раз в 1–2 недели, чтобы предотвратить возвращение симптомов.

Как часто использовать шампунь от перхоти

Используйте шампунь два раза в неделю в течение 2–4 недель, а затем один раз в 1–2 недели, чтобы предотвратить повторное появление перхоти.

Как часто использовать крем или шампунь от отрубевидного лишая

Используйте шампунь один раз в день в течение 5 дней.

Для обработки небольших участков кожи вместо крема можно использовать крем. Наносите крем один или два раза в день в течение 2-3 недель.

Если ваши симптомы возвращаются на солнце, используйте шампунь один раз в день в течение 3 дней перед выходом на солнце.

Как пользоваться кремом с кетоконазолом

  1. Вымойте и высушите зараженный участок кожи. Если вы лечите свои ноги, убедитесь, что вы сушите между пальцами ног.
  2. Используйте собственное полотенце или фланель. Это предотвратит передачу инфекции кому-либо еще.
  3. Аккуратно вотрите крем в зараженную область и окружающую кожу. Обычно вам понадобится небольшое количество, в зависимости от размера области, которую вы лечите. Будьте осторожны, чтобы крем не попал в глаза или рот. Если он попал в глаза или рот, промойте их водой.
  4. После этого вымойте руки. Это остановит распространение инфекции на другие части тела или других людей.

Если вы используете какие-либо другие кремы, мази или лосьоны на том же участке кожи, не наносите их одновременно с кремом кетоконазола. После нанесения крема с кетоконазолом подождите 30 минут, прежде чем использовать разные продукты на одном и том же участке. Это дает кетоконазолу время впитаться в кожу.

Как пользоваться шампунем с кетоконазолом

  1. Промойте волосы или зараженный участок кожи водой.
  2. Встряхните бутылку с шампунем, затем выдавите небольшое количество шампуня на зараженный участок.
  3. Если вы ухаживаете за кожей головы, втирайте шампунь в кожу головы, пока не образуется пена.
  4. Оставьте шампунь на 3–5 минут, затем смойте водой. Старайтесь не допускать попадания шампуня в глаза или рот. При попадании в глаза или рот промойте их водой.
  5. После этого вымойте руки. Это остановит распространение инфекции на другие части тела или других людей.

Что, если я забуду его использовать?

Если вы забыли использовать крем или шампунь с кетоконазолом, просто пропустите пропущенную дозу и продолжайте привычный образ жизни.

Что делать, если я использую слишком много?

Если вы используете слишком много шампуня или крема с кетоконазолом или используете его чаще, чем нужно, это может вызвать раздражение или покраснение кожи. Если это произойдет, используйте меньше в следующий раз.

Кетоконазол крем от микоза стопы. Информация от пациента

о кетоконазоле

.%.%.%.%. Дактарин® Интенсив; Низорал® 2%
Тип лекарства Антинг -винговая медицина
Используется для Гриб -кожные инфекции
также называется также позабоченным
Доступен как Крем

Некоторые виды грибковых микробов обычно встречаются на коже человека.Обычно они не причиняют вреда. Однако при правильных условиях они могут «вторгнуться» в кожу, размножиться и вызвать инфекцию. Условия, которые грибки любят больше всего, это теплые, влажные и безвоздушные участки кожи.

Наиболее распространенными грибками, вызывающими кожные инфекции, являются грибки группы микозов. Эпидермофития стопы (дерматомикоз стоп) — распространенное грибковое заболевание пальцев ног и стоп. Tinea cruris — это грибковая инфекция, которая поражает область паха. Распространенная грибковая инфекция, поражающая влагалище, называется молочницей. Это вызвано чрезмерным ростом Candida, который является дрожжевым грибком (также разновидностью грибка).

Кетоконазол — противогрибковый препарат, который наносится на кожу в виде крема. Он работает, убивая грибок, вызывающий инфекцию. Он доступен по рецепту, и вы также можете купить некоторые бренды без рецепта в аптеках и других торговых точках.

Перед использованием кетоконазола

Чтобы убедиться, что это правильное лечение для вас, перед началом использования крема кетоконазола важно проконсультироваться с врачом или фармацевтом, если:

  • Вы принимаете какие-либо лекарства или используете другие лечебные кремы для кожи.Это включает в себя все, что можно купить без рецепта, а также растительные и дополнительные лекарства.
  • Вы беременны или кормите грудью. Это связано с тем, что пока вы ждете или кормите ребенка, вы должны использовать лекарства только по рекомендации врача.
  • У вас когда-либо была аллергическая реакция на противогрибковый препарат или любой другой продукт для ухода за кожей.

Как применять кетоконазол

  • Перед тем, как начать использовать крем, прочтите печатную информационную брошюру производителя внутри упаковки.Это даст вам больше информации о креме и предоставит вам полный список побочных эффектов, которые могут возникнуть при его использовании.
  • Наносите крем один или два раза в день на пораженный участок. Обратите внимание: вы должны использовать его регулярно два раза в день, если вы лечите микоз.
  • Вымойте и высушите пораженный участок, а затем нанесите на него тонкий слой крема. Прежде чем наносить крем, убедитесь, что участок полностью высох. Не забудьте вымыть руки после нанесения крема, чтобы инфекция не распространилась на другие участки кожи или на других людей.
  • Продолжайте использовать крем до тех пор, пока не исчезнут все признаки инфекции, а затем еще 2–3 дня после этого, чтобы убедиться, что инфекция не вернется.

Получите максимум от своего лечения

  • Чтобы уменьшить вероятность передачи грибка другим людям, всегда используйте отдельное полотенце для других людей, пока ваша инфекция не исчезнет. Чаще стирайте полотенца.
  • Эпидермофития обычно проходит в течение недели при регулярном (два раза в день) лечении.Если по прошествии этого времени признаков улучшения не наблюдается, следует записаться на прием к врачу для получения дополнительной консультации.
  • Инфекции, поражающие область паха и половых органов, могут потребовать до шести недель лечения, чтобы инфекция полностью исчезла. Если после четырех недель регулярного лечения ваши симптомы не улучшаются, запишитесь на прием к врачу для получения дополнительной консультации.
  • Инфекции, поражающие другие участки кожи, могут занять до 3-4 недель лечения, чтобы инфекция исчезла.

Может ли крем с кетоконазолом вызвать проблемы?

Наряду с полезными эффектами большинство лекарств могут вызывать нежелательные побочные эффекты, хотя они проявляются не у всех. В таблице ниже приведены некоторые из них, связанные с кремом кетоконазола. Вы найдете полный список в информационной брошюре производителя, прилагаемой к вашему лекарству. Нежелательные эффекты часто уменьшаются по мере того, как ваше тело приспосабливается к новому лекарству, но поговорите со своим врачом или фармацевтом, если какое-либо из следующих явлений сохраняется или становится неприятным.

Распространенные побочные эффекты крема кетоконазола (им подвержено менее 1 из 10 человек)
Что мне делать, если я столкнулся с этим?
Легкое раздражение, покраснение и зуд Если это не проходит или становится беспокоящим, обратитесь к врачу

Если у вас возникнут какие-либо другие симптомы, которые, по вашему мнению, могут быть вызваны кремом, обратитесь к врачу или фармацевт для получения дополнительной консультации.

Как хранить кетоконазол

  • Храните все лекарства в недоступном для детей месте.
  • Хранить в прохладном, сухом месте, вдали от прямых источников тепла и света.

Важная информация обо всех лекарствах

Этот препарат предназначен для нанесения на кожу. Если вы подозреваете, что кто-то случайно проглотил немного крема, обратитесь в отделение неотложной помощи местной больницы. Возьмите контейнер с собой, даже если он пустой.

Лекарство для тебя. Не давайте его другим людям, даже если их состояние похоже на ваше.

Если вам предстоит операция или лечение зубов, не забудьте сообщить человеку, проводящему лечение, какие лекарства вы принимаете/используете.

Не храните просроченные или ненужные лекарства. Отнесите их в местную аптеку, которая утилизирует их для вас.

Если у вас есть какие-либо вопросы об этом лекарстве, обратитесь к своему фармацевту.

Сравнение антимикробной активности хлоргексидина, кокосового масла, пробиотиков и кетоконазола в отношении Candida albicans, выделенных у детей с кариесом в раннем детстве: исследование in vitro

История вопроса .Ранний детский кариес (ECC) связан с ранней колонизацией и высоким уровнем кариесогенных микроорганизмов. Поскольку C. albicans является одним из них, необходимо определить эффективность против него различных химиотерапевтических средств. Целью исследования является выделение видов Candida у детей с ЭКХ и изучение противогрибкового действия кокосового масла, пробиотиков, Lactobacillus и 0,2% хлоргексидина на C. albicans по сравнению с кетоконазолом. Материалы и методы . Образцы были собраны с помощью стерильных ватных тампонов, взятых с поверхностей зубов у детей с ЭКК в возрасте от 3 до 6 лет, нанесены штрихами на чашки с декстрозным агаром Сабуро (среда HI) и инкубированы в атмосфере, обогащенной 5% CO 2 , при 37°C в течение 24 часа. Candida был выделен, и его чувствительность к пробиотикам, хлоргексидину, кетоконазолу и кокосовому маслу была определена с использованием метода диффузии на диске. Результаты . Средняя зона ингибирования хлоргексидина равнялась 21.8 мм, тогда как для кокосового масла – 16,8 мм, для пробиотиков – 13,5 мм, для кетоконазола – 22,3 мм. Разница между группами не была статистически значимой (значение хи-квадрат 7,42, значение 0,06). Заключение . Хлоргексидин и кокосовое масло показали значительную противогрибковую активность, сравнимую с кетоконазолом.

1. Введение

Болезнь раннего детского кариеса (ECC) определяется как наличие одного или нескольких разрушенных (без полостей или полых поражений), отсутствующих (из-за кариеса) или запломбированных поверхностей зубов в любом молочном зубе в ребенок в возрасте 71 месяца или младше.У детей младше 3 лет любые признаки кариеса с гладкой поверхностью свидетельствуют о тяжелом кариесе раннего детства (S-ECC) [1]. Это связано с ранней колонизацией и высоким уровнем кариесогенных микроорганизмов, высоким уровнем зубного налета, дефектами эмали молочных зубов и диетой, богатой сахаром и углеводами в детстве. Эти первичные факторы риска взаимодействуют, создавая кислую среду в зубном налете, вызывая декальцинацию эмали и дентина. Streptococcus mutans , Lactobacilli и Candida albicans являются преобладающими микроорганизмами, обнаруженными в зубном налете, связанном с кариесом [2].Было введено несколько антимикробных агентов с целью подавления кариесогенных бактерий, что привело к значительному снижению S . мутантов уровня [3]. Вклад C. albicans в общее микробное кислотообразование представляется важным, поскольку он ферментирует глюкозу и мальтозу, образуя как кислоту, так и газ [4]. Было показано, что присутствие Candida усиливает адгезию S. mutans к биопленке ротовой полости и кариозному веществу зуба in vitro [5].Исследования химиотерапевтических подходов к предотвращению или снижению уровней C. albicans , приводящих к развитию кариеса, были ограничены, и существует необходимость определить эффективность различных химиотерапевтических агентов против C. albicans для уменьшения развития кариеса у детей. .

Противогрибковые препараты, такие как азолы (флуконазол, кетоконазол) и полиены (амфотерицин В или нистатин), обычно используются для борьбы с кандидозными инфекциями [6]. Хлоргексидин обладает широким спектром антимикробной активности и используется в качестве местной лечебной добавки.Он также способен ингибировать кандидозную адгезию к биологическим и инертным поверхностям [7]. Кокос ( Cocos nucifera ) является уникальным источником различных натуральных продуктов, полезных для разработки лекарств от различных заболеваний. Части его плодов, такие как ядра кокоса и нежная кокосовая вода, имеют большую лечебную ценность из-за их антимикробных и антиоксидантных свойств [8]. Пробиотические бактерии использовались для модификации микрофлорных экосистем и продемонстрировали некоторый успех в качестве терапевтического средства при заболеваниях полости рта [9].

Это исследование направлено на проверку чувствительности изолятов C. albicans , полученных от детей с РКР, к противогрибковым средствам, кетоконазолу, ополаскивателю для рта, хлоргексидину, кокосовому маслу и пробиотикам, а также на сравнение их антимикробной эффективности.

2. Материалы и методы

Дети с ранним детским кариесом (РДР) в возрастной группе от 3 до 6 лет, консультирующиеся в амбулаторном отделении детской и профилактической стоматологии Каннурского стоматологического колледжа, Анджараканды, взяты в качестве объектов исследования.Дети, получавшие местные или системные антибиотики или противогрибковые препараты, исключаются из исследования. Информированное письменное согласие было получено от сопровождающего ребенка родителя/опекуна. Наличие кариеса (индекс dmfs) у детей регистрировали с использованием видимого света, ротового зеркала и датчика CPI, и на основании опыта кариеса дети с ECC были отобраны для исследования.

Образцы были собраны стерильными ватными тампонами с щечной, язычной, проксимальной и пришеечной частей зубов и немедленно доставлены в лабораторию для микробиологического анализа.Образцы высевали штрихами на чашки с декстрозным агаром Сабуро (HI Media) с добавлением антибиотиков (хлорамфеникол 50  мк г/дл) и инкубировали в атмосфере, обогащенной 5% CO 2 , при 37°C в течение 24 часов и оставляли при комнатной температуре. еще на 24 часа. Рост Candida выглядел как гладкие и пастообразные колонии кремового или белого цвета (рис. 1). Культура считается отрицательной, если рост отсутствует даже после 72 часов инкубации. Идентификация видов Candid проводится с помощью теста на зародышевые пробирки и морфологии на агаре с кукурузной мукой (метод культивирования на чашках Далмау) через 48 часов.Было получено двадцать таких положительных образцов C. albicans .


Противогрибковая активность 2 % кетоконазола (), 0,2 % хлоргексидина (гексидин для полоскания рта), пробиотиков (молочная кислота Bacillus ) и кокосового масла в отношении C. albicans проверена методом диско-диффузии Кирби Бауэра. 0,2% хлоргексидин, кокосовое масло и пробиотики (Визилак, молочная кислота Bacillus ) и 2% кетоконазол наносили на диски фильтровальной бумаги диаметром 6 мм по отдельности (4.0  мкм л/диск) и давали высохнуть.

Суспензии C. albicans готовили в солевом растворе, доведенном до мутности 0,5 по шкале МакФарланда, и равномерно наносили штрихами на агар Мюллера-Хинтона с добавлением 1% глюкозы. Затем на его поверхность на равном расстоянии помещают диски хлоргексидина, кокосового масла, пробиотиков и кетоконазола. Это было сделано для всех 20 изолятов Candida . Затем планшеты инкубировали при 37°С в течение 24 часов и наблюдали за зоной ингибирования вокруг диска (Фигура 2), которую будут измерять и сравнивать.


3. Результаты

Candida был идентифицирован по морфологическим признакам кремовых, гладких, пастообразных выпуклых колоний на SDA. Образование зародышевой трубки и образование конидиоспор подтвердили присутствие C. albicans . Тест на чувствительность к противогрибковым препаратам показал, что C. albicans чувствителен к кетоконазолу, хлоргексидину, кокосовому маслу и пробиотикам благодаря четкой зоне ингибирования.

3.1. Анализ данных

Фенотипы и чувствительность изолятов к противогрибковым препаратам сравнивали друг с другом с помощью непараметрического теста Крускала-Уоллиса для нескольких независимых групп или теста Манна-Уитни для двух независимых групп.

В таблице 1 показано сравнение зоны ингибирования между различными группами. Было установлено, что средняя зона ингибирования для хлоргексидина составила 21,8 мм, для кокосового масла — 16,8 мм, для пробиотиков — 13,5 мм, для кетоконазола — 22,3 мм (рис. 3). Разница между группами не была статистически значимой (значение хи-квадрат 7,42, значение 0,06).

+

Среднее Станд.отклонение хи-квадрат значение

Хлоргексидин 20 21,80 8,458 7,429
Кокосовое масло 20 16,80 12,846
Пробиотики 20 13,50 13,656
Кетоконазол 20 22,30 15,076
Итого 80 18.60 13,033

NS: незначимый дисперсионный анализ Крускала-Уоллиса.

Зона ингибирования между ЦГХ и кетоконазолом сравнивается в таблице 2. Было установлено, что средняя зона ингибирования для хлоргексидина составляет 21,8 мм, тогда как для кетоконазола она составляет 22,3 мм. Разница между группами не была статистически значимой (значение 0,54). Сравнение зоны ингибирования между кокосовым маслом и кетоконазолом показано в таблице 3.Результаты показывают, что средняя зона ингибирования для кокосового масла составляет 12,8 мм, тогда как для кетоконазола она составляет 22,3 мм. Разница между группами не была статистически значимой (значение 0,07). Зона ингибирования пробиотиков и кетоконазола показана в таблице 4. Здесь можно наблюдать вариацию, поскольку она показывает, что средняя зона ингибирования для пробиотиков составляла 13,5 мм, тогда как для кетоконазола она составляла 22,3 мм, а разница между группами была статистически значимой. (значение 0.02).

8 и 90BC3 гены CgCDR1 и CgCDR2 с помощью количественной ПЦР в реальном времени (qRT-PCR).Образцы тотальной РНК получали из клеточных суспензий, собранных при достижении OD 600 нм = 0,8 ± 0,08 (клетки средней экспоненциальной фазы). кДНК для ПЦР с обратной транскрипцией в реальном времени синтезировали из образцов тотальной РНК с использованием набора обратной транскриптазы MultiScribe TM (Applied Biosystems) и блока термоциклера 7500 RT-PCR (Applied Biosystems). Количество кДНК для последующих реакций поддерживали на уровне ок. 10 нг. Последующий этап ОТ-ПЦР проводили с использованием реагентов SYBR green.Праймеры для амплификации пяти генов и CgACT1 были разработаны с использованием программного обеспечения Primer Express (Applied Biosystems) и представлены в таблице 1. ОТ-ПЦР проводили с использованием блока термоциклера (система ПЦР в реальном времени 7500; Applied Biosystems). Биосистемы). Использовали параметры по умолчанию, установленные производителем, и флуоресценцию определяли с помощью прибора и записывали на график амплификации (программное обеспечение 7500 System SDS; Applied Biosystems). Уровень мРНК CgACT1 использовали в качестве внутреннего контроля.Относительные значения, полученные для чувствительного к клотримазолу изолята, проявляющего более низкий уровень экспрессии гена, были приняты за 1, а остальные значения представлены относительно этого контроля. Статистический анализ результатов проводили с использованием ANOVA, и различия считали статистически значимыми для p -значений <0,05.

ТАБЛИЦА 1. Пары праймеров, разработанные для ОТ-ПЦР.

Разрушение

CgTPO3

Делецию гена CgTPO3 проводили в родительском штамме 51800 с использованием метода, описанного Reuss et al.(2004). Ген должен быть удален был заменен на SAT1 перекладывающего кассеты путем гомологичной рекомбинации с использованием праймеров 5 ‘- CCCTCCAATCCAGATTGACGCAGTGGGGTTATAGGTTAC TGAGGTGTTTCTATATATACA ATGGACGGTGGTATGTTT — 3′ и 5 ‘- ATATATTATGATTCAATGAGAAGTACATTAGATG TAGGAGGTGGAAGTAAGGGGAGTTGT TTAGGCGTCATCCTGTGCTC — 3′ . Подчеркнутая область праймеров имеет гомологию с геном, подлежащим амплификации, в то время как выделенная курсивом область имеет гомологию с последовательностью, кодирующей кассету флиппера SAT1 .Плазмиду pA83, включающую CgSAT1 , использовали в качестве матрицы, и трансформацию проводили с использованием набора для трансформации дрожжей Alkali-Cation (MP Biomedicals). Подходящие продукты ПЦР идентифицировали и проверяли с помощью ПЦР с использованием следующих пар праймеров: 5′-CAGAATTTGAACCTTCGGGTG-3′, который относится к внутренней части открытой рамки считывания CgTPO3 , и 5′-GCCCAGATAACAACACAAGTCC-3′, который специфичен для кассеты ДНК. Из матричной ДНК мутанта продукты ПЦР не были идентифицированы, в то время как чистый продукт ПЦР был идентифицирован из матричной ДНК родительского штамма.

[

3 H]-Клотримазол Транспортные анализы Анализ накопления

[ 3 H]-клотримазола проводили, как описано ранее (Costa et al., 2013b). Для оценки его накопления (внутриклеточного/внеклеточного) в дрожжевых клетках их выращивали в среде ВМ до середины экспоненциальной фазы, собирали, промывали и ресуспендировали в среде ВМ для получения клеточных суспензий с OD600 нм = 5,0 ± 0,1, что эквивалентно примерно 2,2. мг (сухой вес) мл -1 . Через 5 мин термостатирования при 30°С 0.К суспензии добавляли 1 мкМ 3 H-клотримазола (American Radiolabeled Chemicals; 1 мКи/мл) и 30 мг/л немеченого клотримазола. За накоплением 3 Н-клотримазола в течение 30 мин следовало фильтрование 200 мкл клеточной суспензии через соответствующие интервалы времени через фильтры из стеклянного микроволокна (Whatman GF/C). Фильтры промывали охлажденным льдом ТМ-буфером и измеряли радиоактивность на сцинтилляционном счетчике Beckman LS 5000TD. Внеклеточную концентрацию 3 H-клотримазола оценивали по радиоактивности 50 мкл супернатанта.Для расчета внутриклеточной концентрации каждого радиоактивно меченого соединения внутренний объем клеток (Vi) экспоненциальных клеток, выращенных в отсутствие лекарственного средства и использованных для анализа накопления, считали постоянным и равным 2,5 мкл (мг сухого веса) -1 (Роза и Са-Коррейя, 1996). Статистический анализ результатов проводили с использованием ANOVA, и различия считали статистически значимыми для p -значений <0,05.

Результаты

Профили восприимчивости

C.glabrata Изоляты клотримазола и флуконазола

В этом исследовании 138 изолятов C. glabrata , поступивших из двух крупных португальских больниц, были проверены на устойчивость к азолам. Большинство этих изолятов было получено от женщин (64%) и от лиц старше 65 лет (54%). Наиболее распространенными нишами, из которых они были извлечены, были моча (31%), посев крови (19%), слизь (16%) и в меньшем количестве из вагинального мазка, бронхоальвеолярного лаважа, гноя, кала и перитонеальной жидкости (дополнительная таблица S1). ).Уровни устойчивости к FLC для 29% этой коллекции, соответствующие изолятам O и OL, собранным в Centro Hospitalar S. João (CHSJ), были получены ранее (Costa-de-Oliveira et al., 2008, 2011; Faria-Ramos et al. др., 2014).

Профили чувствительности к CLT и FLC для всех изолятов C. glabrata приведены в таблице 2 (подробности см. в дополнительной таблице S1). Что касается значений МИК 50 , было обнаружено, что большинство изолятов (93,5%) чувствительны к СЛЦ в зависимости от дозы, в то время как 9 (6.5%) оказались устойчивыми к FLC. Кроме того, было обнаружено, что большинство изолятов (64,5%) устойчивы к CLT. Интересно, что 48 изолятов (34,78%) оказались устойчивыми к CLT и, в то же время, чувствительными к дозозависимому FLC. Однако обратного не наблюдалось ни для одного из тестируемых штаммов. Что касается CLT, 53,3% изолятов, полученных из больницы Санта-Мария (HSM), оказались устойчивыми, в то время как изоляты, собранные в CHSJ, имели гораздо более высокий уровень устойчивости к клотримазолу (77.8%). Изоляты, устойчивые к флуконазолу, имели более высокую заболеваемость HSM (10,7% против 1,6%). Интересно, что с помощью теста Спирмена (коэффициент Спирмена: 0,27) была обнаружена значительная корреляция между увеличением уровней CLT MIC и уровнями MIC FLC при рассмотрении полных 138 клинических изолятов (рис. 1). Уровень корреляции, однако, относительно низок, что объясняет ряд изолятов, проявляющих устойчивость к CLT и очень низкие значения MIC FLC, и позволяет предположить, что могут быть различия в молекулярных механизмах приобретения устойчивости к этим родственным азоловым препаратам.

ТАБЛИЦА 2. Профили чувствительности изолятов 138 Candida glabrata к широко используемым противогрибковым препаратам клотримазолу и флуконазолу методом микроразведений в эталонном бульоне .

РИСУНОК 1. Корреляция между значениями МПК флуконазола и клотримазола 50 , определенными для коллекции 138 Candida glabrata клинических изолятов. Также отображается линия тренда, полученная путем линейной регрессии значений корреляции. С помощью теста Спирмена (0,27) была обнаружена значительная корреляция между наборами данных клотримазола (CLT) и флуконазола (FLC).

Было обнаружено, что процент устойчивых к клотримазолу и флуконазолу изолятов одинаков как при поверхностных инфекциях, так и при инфекциях крови: 63% устойчивых изолятов при инфекциях крови и 64,9% устойчивых изолятов при поверхностных инфекциях для клотримазола и 7.4% изолятов, устойчивых к инфекциям крови, и 6,3% изолятов, устойчивых к поверхностным инфекциям, к флуконазолу.

Устойчивость к клотримазолу у

C. glabrata Клинические изоляты коррелируют с экспрессией генов DHA

Чтобы оценить предполагаемую роль антипортеров Drug:H + CgAqr1, CgQdr2, CgTpo1_1, CgTpo1_2 и CgTpo3 в клиническом приобретении лекарственной устойчивости к азолам (Costa et al., 2014a), были оценены уровни их экспрессии в 20 клинических изолятах, 10 из которых проявляли устойчивость к клотримазолу и 10 проявляли чувствительность к клотримазолу (таблица 3). Возможность рассматривать для дальнейшего анализа штаммы R или S клотримазола, а не штаммы R/SDD флуконазола, связана с тем фактом, что все анализируемые в этом исследовании переносчики лекарственных средств придают устойчивость к имидазолу, но только три придают также устойчивость к триазолу. Выбранные изоляты также были отобраны по показателю наиболее экстремальных значений MIC.Уровни экспрессии генов CgCDR1 и CgCDR2 ABC, кодирующих насос множественного лекарственного оттока, также определяли для сравнения, поскольку их избыточная экспрессия обычно считается ключевым фактором в клиническом приобретении лекарственной устойчивости к азолам (Miyazaki и др., 1998; Санглард и др., 1999).

Таблица 3. Список из клотримазол чувствительными и резистентными C. glabrata клинических изолятов, выбранные для определения уровней экспрессии генов DHA CgAQR1 девяносто одна тысяча сто семьдесят один, CgQDR2 девяносто одна тысяча сто семьдесят один, CgTPO1_1 , CgTPO1_2 и CgTPO3 , а также генов ABC CgCDR1 и 9197 9127 1CDR .

Гораздо более высокая вариабельность экспрессии гена DHA была обнаружена у штаммов, устойчивых к азолу, по сравнению с восприимчивыми штаммами. Несмотря на эту изменчивость, уровень транскриптов генов CgAQR1, CgQDR2 , CgTPO1_1 и CgTPO3 оказался значительно выше у резистентных изолятов по сравнению с восприимчивыми, учитывая более 70% тестируемых штаммов ( Рисунки 2А-С, Е). В случае CgTPO1_2 статистически значимой корреляции не наблюдалось (рис. 2D).Как и ожидалось (Miyazaki et al., 1998; Sanglard et al., 1999; Bennett et al., 2004), было обнаружено, что экспрессия CgCDR1 и CgCDR2 коррелирует с резистентностью к азолу у клинических изолятов (рис. 3). ). Важно отметить, что было обнаружено, что уровень корреляции между экспрессией CgCDR2 и устойчивостью к азоловым препаратам аналогичен уровню, наблюдаемому для генов DHA ( p -значение <0,05). В соответствии с более значимой ролью в этом контексте более высокая степень корреляции между экспрессией генов и устойчивостью к азоловым препаратам была обнаружена для CgCDR1 ( p -значение <0.01).

Рисунок 2. Уровни транскриптов (A) CGAQR1 , (B) CGQDR2 , (C) CGTPO1_111719199, (C) CGTPO1_111719199, (C) CGTPO1_11171 , D). CgTPO3 как в чувствительных (S), так и в устойчивых (R) C. glabrata клинических изолятов. Уровни транскриптов оценивали с помощью количественной ОТ-ПЦР, как описано в разделе «Материалы и методы».Полученные значения являются средними как минимум из трех независимых экспериментов. Среднее значение экспрессии в каждой группе клинических изолятов представлено красной линией (). * p -значение < 0,05.

РИСУНОК 3. Уровни транскриптов (A) CgCDR1 и (B) CgCDR2 как в чувствительных (S), так и в устойчивых (R) клинических изолятах 917sglabrata C.19170 Уровни транскриптов оценивали с помощью количественной ОТ-ПЦР, как описано в разделе «Материалы и методы».Полученные значения являются средними как минимум из трех независимых экспериментов. Среднее значение экспрессии в каждой группе клинических изолятов представлено красной линией (). p -значение < 0,05, ∗∗ p -значение < 0,01.

Экспрессия CgTPO3 способствует устойчивости к азолу в резистентном клиническом изоляте Ранее было показано, что

CgTPO3 способствует устойчивости лабораторного штамма к клотримазолу и флуконазолу (Costa et al., 2014б). Учитывая наблюдение, что этот ген активируется у устойчивых к клотримазолу клинических изолятов по сравнению с чувствительными, представляется важным оценить, может ли его отсутствие влиять на устойчивость к азолам и у клинических изолятов. Следовательно, этот ген был делетирован в азол-резистентном изоляте 51800, который, как было обнаружено, проявлял высокие уровни экспрессии CgTPO3 . Было обнаружено, что делеция этого гена в изоляте 51800 значительно снижает его устойчивость к клотримазолу и флуконазолу (рис. 4А, В), тем самым подтверждая мнение о том, что этот переносчик способствует устойчивости к азолам в клиническом контексте.Далее оценивали значения МИК 50 клотримазола и флуконазола для 51800 и 51800_Δ cgtpo3 . Было обнаружено, что значения МИК 50 во всех случаях выше у исходного штамма 51800 (8 и >128 для клотримазола и флуконазола соответственно), чем у производного делеционного мутанта Δ cgtpo3 (4 и 64 соответственно).

РИСУНОК 4. Сравнение чувствительности клинического изолята 51800 и производного мутанта 51800_Δ cgtpo3 к клотримазолу и (B) флуконазолу в указанных концентрациях, в чашках с делецией BM пятном пробы. Суспензии клеток, использованные для приготовления пятен, составляли (b) 1:5 и (c) 1:25 клеточной суспензии, использованной в (a). Отображаемые изображения являются репрезентативными как минимум для трех независимых экспериментов.

На основании полученных результатов чувствительности становится очевидным, что CgTpo3 играет роль в приобретении клинической лекарственной устойчивости, но не несет полной ответственности за устойчивость к клотримазолу и флуконазолу у изолята 51800. Действительно, было обнаружено, что экспрессия дополнительных генов, кодирующих переносчики многих лекарственных средств, в этом штамме довольно высока по сравнению с тем, что было определено в дозозависимых изолятах, чувствительных к азолу (рис. 5).Это особенно относится к генам CDR1 и AQR1 (рис. 4), что подчеркивает многофакторный характер приобретения лекарственной устойчивости к азолам в клинических условиях.

Рисунок 5. уровни транскриптов из CgAQR1, CgQDR2, CgTPO1 _ 1 , девяносто одна тысяча сто семьдесят-одна CgTPO1_2, CgTPO3, CgCDR1 и CgCDR2 в C.glabrata клинический изолят 51800 по сравнению с таковыми, определенными в восприимчивом изоляте, демонстрирующем самый низкий уровень экспрессии каждого из этих генов. Уровни транскрипта оценивали с помощью количественной ОТ-ПЦР, как описано в разделе «Материалы и методы». Полученные значения являются средними по крайней мере из трех независимых экспериментов. Столбики погрешностей представляют собой соответствующее стандартное отклонение.

CgTPO3 Медиаты 3 Эфлюкс H-клотримазола в клотримазол-резистентном изоляте 51800

Учитывая это наблюдение и предыдущую демонстрацию того, что CgTPO3 опосредует отток 3 H-клотримазола в C.glabrata (Costa et al., 2014b), оценивали способность CgTpo3 снижать накопление радиоактивно меченого клотримазола в клиническом изоляте 51800 C. glabrata . Оценивали накопление 3 H-меченого клотримазола в неадаптированных клетках C. glabrata 51800 и 51800_Δ cgtpo3 , подвергшихся внезапному воздействию 30 мг/л холодного клотримазола (рис. 6А). В этих условиях клетки, лишенные CgTPO3 , накапливают в два раза более высокие уровни 3 Н-клотримазола по сравнению с родительским штаммом.Поскольку возможно, что наблюдаемая умеренная роль, которую CgTpo3 играет в устойчивости к клотримазолу, может быть результатом косвенного влияния на экспрессию CgCDR1 или CgCDR2 , влияние делеции CgTPO3 в клиническом изоляте 51800 на экспрессию CgCDR1 и CgCDR2 оценивали. Было обнаружено, что делеция CgTPO3 оказывает лишь незначительное влияние на экспрессию CgCDR2 и не влияет на CgCDR1 (фиг. 6B).Этот результат убедительно свидетельствует о том, что активность CgTpo3 повышает устойчивость 90–198 C. glabrata 90–199 к клотримазолу у клинических изолятов за счет непосредственного снижения его накопления внутри клетки.

РИСУНОК 6. (A) Коэффициент накопления [ 3 H]-клотримазола в неадаптированных клетках родительского штамма 51800 () или мутантного штамма 51800_ Δcgtpo3 (), при культивировании в Жидкая среда БМ в присутствии 30 мг/л немеченого клотримазола. (B) Уровни транскриптов CgCDR1 (черный цвет) и CgCDR2 (белый цвет) в клиническом изоляте C. glabrata 51800 по сравнению с уровнями, определенными в делеции, полученной из 51800_ Δcgtpo3 . Уровни транскрипта оценивали с помощью количественной ОТ-ПЦР, как описано в разделе «Материалы и методы». Полученные значения являются средними по крайней мере из трех независимых экспериментов. Столбики погрешностей представляют собой соответствующие стандартные отклонения. p -значение < 0,05, ∗∗ p -значение < 0,01.

Обсуждение

В этой работе оценивали участие пяти мультилекарственных переносчиков суперсемейства MFS в приобретении устойчивости к клотримазолу у клинических изолятов C. glabrata .

Препарат: H + Семейство Antiporter слабо охарактеризовано в патогенных грибах. Например, в значимых с медицинской точки зрения патогенах C. albicans , C.glabrata , С. parapsilosis , С. lusitaniae , С. tropicalis , С. guilliermondii , Cryptococcus neoformans , и аспергилл дымящийся есть около 300 ORF, предсказанные для кодирования DHA транспортеров, но только охарактеризовано менее 15 (Costa et al., 2014a). У C. glabrata пять переносчиков, CgAqr1 (Costa et al., 2013a), CgQdr2 (Costa et al., 2013b), CgTpo1_1, CgTpo1_2 (Pais et al., 2016) и CgTpo3 (Costa et al., 2014b), недавно были функционально проанализированы, и было показано, что они участвуют в формировании лекарственной устойчивости к азолам с более сильным эффектом в отношении устойчивости к имидазолам. Однако влияние этих результатов на клиническое приобретение резистентности оставалось неясным.

В этой работе 138 клинических изолятов C. glabrata были проверены на устойчивость к клотримазолу и флуконазолу. Большинство изолятов были охарактеризованы как чувствительные к дозе флуконазола, в то время как 9 (6.5%) были идентифицированы как устойчивые к этому препарату. Относительный уровень устойчивых изолятов был аналогичен тому, который наблюдался в предыдущих исследованиях (Sanguinetti et al., 2005; Faria-Ramos et al., 2014). С другой стороны, большинство протестированных изолятов (64,5%) оказались устойчивыми к клотримазолу. Было обнаружено, что большинство изолятов устойчивы к клотримазолу и зависимы от дозы флуконазола. Однако важно отметить, что идентификация очень большого числа устойчивых к клотримазолу изолятов, скорее всего, связана с тем фактом, что рассматриваемый порог устойчивости был установлен для 90–198 C.albicans (Pelletier et al., 2000), поскольку для C. glabrata никогда не указывалось пограничное значение МПК для клотримазола или предполагаемый порог устойчивости (CLSI, 2008, 2012). На основании того факта, что пограничная точка флуконазола в восемь раз выше для C. glabrata , чем для C. albicans (CLSI, 2012), представляется разумным предположить, что пограничная точка для клотримазола для C. glabrata также будет выше, чем для C. glabrata . для C. albicans . Учитывая аналогичную восьмикратную разницу, пограничная точка клотримазола увеличилась бы до MIC, равной 4, что по-прежнему будет означать, что почти 30% клинических изолятов в изученной коллекции проявляют устойчивость к этому азоловому препарату.

Резистентность (или восприимчивость) к клотримазолу и флуконазолу, по-видимому, не коррелирует с нишей организма, из которой были выделены изоляты C. glabrata . Кроме того, уровни устойчивости к обоим препаратам одинаковы независимо от того, получены ли изоляты из культур крови или поверхностных инфекций. Это особенно интересно и неожиданно, поскольку флуконазол чаще используется для лечения системных инфекций, а клотримазол — для лечения поверхностных инфекций.

Поскольку азолы играют такую ​​важную роль в клинической практике, также рассматривался потенциал перекрестной резистентности между имидазолами и триазолами.Интересно, что 48 изолятов (34,78%), устойчивых к клотримазолу, оказались в то же время чувствительными к дозозависимому действию флуконазола. В соответствии с наблюдением, что существует статистически значимая корреляция между повышением уровней МПК CLT и уровнями МИК СЛЦ, при рассмотрении полных 138 клинических изолятов все изоляты, идентифицированные как устойчивые к флуконазолу ( n = 9), также были признаны устойчивыми к клотримазолу при рассмотрении устойчивости CLT для МПК ≥ 1.Это согласуется с наблюдением Cross et al. (2000) показали, что устойчивые к флуконазолу изоляты кровотока как C. albicans , так и C. glabrata , полученные от онкологических больных, показали одновременную устойчивость к клотримазолу и двум другим имидазолам: тиоконазолу и миконазолу. Эти наблюдения поднимают вопрос о профилактическом применении флуконазола, поскольку он может вызывать резистентность не только к другим триазолам (Pfaller et al., 2004, 2007, 2008), но и к более широко используемым имидазолам, что затрудняет лечение поверхностных инфекций.

Используя результаты, полученные при характеристике упомянутых выше коллекций изолятов, была оценена роль транспортеров DHA1 CgAqr1, CgQdr2, CgTpo1_1, CgTpo1_2 и CgTpo3 в приобретении устойчивости к клотримазолу в клинических условиях. Вариант рассмотрения клотримазола R, а не флуконазола R обусловлен тем фактом, что все анализируемые в этом исследовании переносчики лекарств придают устойчивость к имидазолу, но только CgTpo1_1, CgTpo1_2 и CgTpo3 также придают устойчивость к триазолу.Хотя верно то, что флуконазол и другие триазольные противогрибковые препараты гораздо более актуальны при лечении системных опасных для жизни грибковых инфекций, имидазольные противогрибковые препараты, такие как клотримазол, широко используются при инфекциях кожи и слизистых оболочек, которые сами по себе являются широко распространенной проблемой с высокой частотой рецидивов. , и представляет собой открытую дверь для развития инфекций кровотока. Было показано, что уровни экспрессии четырех из пяти из этих генов ( CgAQR1 , CgQDR2 , CgTPO1_1 и CgTPO3 ) напрямую коррелируют с повышением устойчивости к клотримазолу и значительно повышаются у устойчивых к клотримазолу изолятов. по сравнению с восприимчивыми изолятами.Интересно, что ранее было показано, что экспрессия CgQDR2 повышена в клиническом изоляте, проявляющем мутацию усиления функции CgPDR1 (Caudle et al., 2011). Однако для остальных генов DHA, рассмотренных в этом исследовании, это первая демонстрация положительной регуляции в клинических изолятах, возможно, потому, что, насколько нам известно, нет других исследований, посвященных клиническому приобретению устойчивости к клотримазолу. Хотя корреляция между экспрессией генов и устойчивостью к клотримазолу оказалась выше для CgCDR1 , как и ожидалось, учитывая его более заметную роль в этом контексте (Miyazaki et al., 1998; Санглард и др., 1999; Bennett et al., 2004), экспрессия генов DHA имела уровень корреляции, аналогичный уровню CgCDR2 . Это особенно важно, поскольку транспортеры DHA охарактеризованы гораздо хуже, чем транспортеры ABC. Фактически, до недавних исследований, характеризующих эти транспортеры C. glabrata DHA, единственным транспортером MFS, который был описан как участвующий в лекарственной устойчивости, был C. albicans Mdr1 (Cannon et al., 2009; Morschhauser, 2010).Участие этого переносчика в клиническом приобретении резистентности было продемонстрировано значительной повышающей регуляцией уровней экспрессии его гена у 90–198 клинических изолятов C. albicans 90–199, устойчивых к флуконазолу (Sanglard et al., 1995; White, 1997), и повышенная восприимчивость к этому препарату при разрушении гена, доказывающая, что этот переносчик опосредует устойчивость к флуконазолу у клинических изолятов C. albicans (Wirsching et al., 2000b).

Интересно, что единственным геном, для которого не удалось обнаружить корреляции между уровнями экспрессии и приобретением устойчивости, был CgTPO1_2 .Это наблюдение было несколько неожиданным, поскольку ранее наблюдалось, что его экспрессия повышалась после воздействия клотримазола (Pais et al., 2016). Однако это отсутствие корреляции может быть связано с тем, что экспрессия этого гена происходит временным образом (Pais et al., 2016). Кроме того, высокая вариабельность между уровнями экспрессии CgTPO1_2 в устойчивых изолятах по сравнению с чувствительными изолятами поставила под угрозу статистическую значимость, связанную с корреляцией между уровнями транскриптов в этих группах изолятов и их уровнями устойчивости.Действительно, следует отметить, что средние уровни экспрессии CgTPO1_2 все же оказались значительно выше среди резистентных изолятов, чем среди восприимчивых.

Подобно тому, что было сделано ранее для CaMdr1 (Wirsching et al., 2000b), релевантность CgTpo3 была дополнительно оценена посредством делеции гена в клиническом изоляте, отобранном по показателю высокого уровня экспрессии CgTPO3 . Используемый здесь в качестве доказательства концепции тот факт, что делеция CgTpo3 в этом клиническом изоляте снижает устойчивость к клотримазолу и флуконазолу к азольным препаратам, демонстрирует его важность в клиническом приобретении устойчивости к азоловым препаратам.Также интересно отметить, что все протестированные устойчивые к азолу изоляты демонстрируют повышенную экспрессию нескольких переносчиков лекарств ABC и DHA. Однако профиль их экспрессии варьируется от штамма к штамму, что позволяет предположить, что несколько путей эволюции были выбраны разными штаммами, что привело к одному и тому же общему фенотипу устойчивости к азолам. В самом деле, по-видимому, это сумма действий, оказываемых каждым из насосов с повышающей регуляцией оттока лекарственного средства, а не обязательно их индивидуальное действие, которое в конечном итоге приводит к созданию полностью устойчивого клинического изолята.

В целом, это исследование подчеркивает важность семейства переносчиков DHA в приобретении лекарственной устойчивости к азолам. Примечательно, что эти переносчики широко распространены среди патогенных грибов, но пока охарактеризовано лишь около 5% из них (Costa et al., 2014a).

Вклад авторов

CC выполнил большую часть экспериментальной работы и участвовал в написании рукописи. MT и AG совместно задумали эту работу и внесли свой вклад в написание рукописи.JR, IM, AS-D, MC и SC-O внесли свой вклад в экспериментальную работу.

Заявление о конфликте интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Благодарности

Мы благодарим профессора Хосе Мело-Кристино, медицинский факультет Лиссабонского университета, за предоставление нам доступа к штаммам, собранным в HSM. Эта работа была поддержана «Fundação para a Ciência e a Tecnologia» (FCT) [контракты PTDC/EBB-BIO/119356/2010, PTDC/BBB-BIO/4004/2014 и UID/BIO/04565/2013, а также постдокторские гранты к CC (SFRH/BD/100863/2014) и IMM (SFRH/BD/113285/2015).Спонсоры не участвовали в разработке исследования, сборе и интерпретации данных или в принятии решения о представлении работы для публикации.

Дополнительный материал

Дополнительный материал к этой статье можно найти в Интернете по адресу: https://www.frontiersin.org/article/10.3389/fmicb.2016.00526

.

Ссылки

Аббес, С., Мэри, К., Селлами, Х., Мишель-Нгуен, А., Аяди, А., и Ранк, С. (2013). Взаимодействия между числом копий и уровнем экспрессии генов, участвующих в устойчивости к флуконазолу у Candida glabrata . Перед. Клетка заражает микробиол. 3:74. doi: 10.3389/fcimb.2013.00074

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Беннетт, Дж. Э., Изумикава, К., и Марр, К. А. (2004). Механизм повышения устойчивости к флуконазолу у Candida glabrata во время профилактики. Антимикроб. Агенты Чемотер. 48, 1773–1777. doi: 10.1128/AAC.48.5.1773-1777.2004

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Кэннон, Р.Д., Лэмпинг Э., Холмс А.Р., Ниими К., Барет П.В., Кения М.В. и соавт. (2009). Эфлюкс-опосредованная резистентность к противогрибковым препаратам. клин. микробиол. Ред. 22, 291–321. doi: 10.1128/CMR.00051-08

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Кодл, К. Э., Баркер, К. С., Видерхольд, Н. П., Сюй, Л., Хомаюни, Р., и Роджерс, П. Д. (2011). Анализ полногеномного профиля экспрессии регулона Candida glabrata Pdr1. Эукариот. Ячейка 10, 373–383.doi: 10.1128/EC.00073-10

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Чен, К. Х., Миядзаки, Т., Цай, Х. Ф., и Беннетт, Дж. Э. (2007). Фактор транскрипции bZip Cgap1p участвует в развитии множественной лекарственной устойчивости и необходим для активации гена транспортера множественных лекарств CgFLR1 у Candida glabrata . Ген 386, 63–72. doi: 10.1016/j.gene.2006.08.010

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

КЛСИ (2008 г.). Эталонный метод тестирования дрожжей на чувствительность к противогрибковым разбавлениям в бульоне, CLSI M27-A3 , 3rd Edn. Уэйн, Пенсильвания: Институт клинических и лабораторных стандартов.

Академия Google

КЛСИ (2012 г.). M27-S4 Эталонный метод для тестирования дрожжей на чувствительность к противогрибковым разведениям в бульоне; Четвертое информационное приложение. Уэйн, Пенсильвания: Институт клинических и лабораторных стандартов.

Академия Google

Коста, К., Диас, П.Дж., Са-Коррейя, И.и Тейшейра, М.К. (2014a). Транспортеры множественных лекарств MFS в патогенных грибах: имеют ли они реальное клиническое значение? Перед. Физиол. 5:197. doi: 10.3389/fphys.2014.00197

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Коста, К., Энрикес, А., Пирес, К., Нунес, Дж., Оно, М., Чибана, Х., и другие. (2013а). Двойная роль препарата Candida glabrata : H+ антипортера CgAqr1 (ORF CAGL0J09944g) в устойчивости к противогрибковым препаратам и уксусной кислоте. Перед.микробиол. 4:170. doi: 10.3389/fmicb.2013.00170

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Коста, К., Нуньес, Дж., Энрикес, А., Мира, Н.П., Накаяма, Х., Чибана, Х., и др. (2014б). Candida glabrata лекарство: H+ антипортер CgTpo3 (ORF CAGL0I10384g): роль в устойчивости к азоловым препаратам и гомеостазе полиаминов. J. Антимикроб. Чемотер. 69, 1767–1776 гг. doi: 10.1093/jac/dku044

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Коста, К., Pires, C., Cabrito, T.R., Renaudin, A., Ohno, M., Chibana, H., et al. (2013б). Candida glabrata лекарство: H+ антипортер CgQdr2 придает лекарственную устойчивость к имидазолу, активируясь фактором транскрипции CgPdr1. Антимикроб. Агенты Чемотер. 57, 3159–3167. doi: 10.1128/AAC.00811-12

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Коста-де-Оливейра, С., Маркос Миранда, И., Силва, Р. М., Пинто, Э. С. А., Роша, Р., Аморим, А., и др. (2011).Мутации FKS2 связаны со снижением чувствительности к эхинокандину Candida glabrata после терапии анидулафунгином. Антимикроб. Агенты Чемотер. 55, 1312–1314. doi: 10.1128/AAC.00589-10

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Коста-де-Оливейра, С., Пина-Ваз, К., Мендонка, Д., и Гонсалвеш Родригес, А. (2008). Первое португальское эпидемиологическое исследование грибковой инфекции в университетской больнице. евро. Дж. Клин. микробиол.Заразить. Дис. 27, 365–374. doi: 10.1007/s10096-007-0448-4

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Кросс, Э. У., Парк, С., и Перлин, Д. С. (2000). Перекрестная устойчивость клинических изолятов Candida albicans и Candida glabrata к безрецептурным азолам, используемым при лечении вагинита. Микроб. Сопротивление наркотикам. 6, 155–161. дои: 10.1089/1076629474

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Куэнка-Эстрелла, М., Lee-Yang, W., Ciblak, M.A., Artington-Skaggs, B.A., Mellado, E., Warnock, D.W., et al. (2002). Сравнительная оценка процедур микроразведения бульона NCCLS M27-A и EUCAST для тестирования чувствительности к противогрибковым препаратам видов Candida . Антимикроб. Агенты Чемотер. 46, 3644–3647. doi: 10.1128/AAC.46.11.3644-3647.2002

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Фариа-Рамос, И., Невес-Майя, Дж., Рикардо, Э., Сантос-Антунес, Дж., Сильва, А.Т., Коста-Де-Оливейра С. и др. (2014). Распределение видов и профили противогрибковой чувствительности in vitro изолятов дрожжей от инвазивных инфекций во время многоцентрового исследования в Португалии. евро. Дж. Клин. микробиол. Заразить. Дис. 33, 2241–2247. doi: 10.1007/s10096-014-2194-8

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Генри, К.В., Никелс, Дж.Т., и Эдлинд, Т.Д. (2000). Активация генов ERG у видов Candida азолами и другими ингибиторами биосинтеза стеролов. Антимикроб. Агенты Чемотер. 44, 2693–2700. doi: 10.1128/AAC.44.10.2693-2700.2000

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Martel, C.M., Parker, J.E., Bader, O., Weig, M., Gross, U., Warrilow, A.G., et al. (2010). Идентификация и характеристика четырех устойчивых к азолу мутантов erg3 Candida albicans . Антимикроб. Агенты Чемотер. 54, 4527–4533. doi: 10.1128/AAC.00348-10

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Миядзаки, Х., Миядзаки Ю., Гебер А., Паркинсон Т., Хичкок С., Фальконер Д. Дж. и соавт. (1998). Резистентность к флуконазолу связана с оттоком лекарства и повышенной транскрипцией гена переносчика лекарства, PDh2, у Candida glabrata . Антимикроб. Агенты Чемотер. 42, 1695–1701.

Академия Google

Паис П., Коста К., Пирес К., Симидзу К., Чибана Х. и Тейшейра М. К. (2016). Мембранный протеомный ответ на противогрибковый препарат клотримазол у Candida glabrata : роль фактора транскрипции CgPdr1 и антипортеров Drug:H+ CgTpo1_1 и CgTpo1_2. Мол. Клетка. Протеомика 15, 57–72. doi: 10.1074/mcp.M114.045344

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Папон, Н., Курдаво, В., Кластр, М., и Беннетт, Р. Дж. (2013). Появляющиеся и появившиеся патогенные виды Candida : за пределами парадигмы Candida albicans . PLoS Патог. 9:e1003550. doi: 10.1371/journal.ppat.1003550

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Пеллетье, Р., Peter, J., Antin, C., Gonzalez, C., Wood, L., and Walsh, T.J. (2000). Возникновение устойчивости Candida albicans к клотримазолу у детей, инфицированных вирусом иммунодефицита человека: in vitro и клинические корреляции. Дж. Клин. микробиол. 38, 1563–1568.

Реферат PubMed | Академия Google

Pfaller, M.A., Espinel-Ingroff, A., Boyken, L., Hollis, R.J., Kroeger, J., Messer, S.A., et al. (2011). Сравнение метода микроразведений в бульоне (BMD) Европейского комитета по тестированию чувствительности к противомикробным препаратам с 24-часовым методом CLSI BMD для тестирования чувствительности видов Candida к флуконазолу, позаконазолу и вориконазолу с использованием эпидемиологических пороговых значений. Дж. Клин. микробиол. 49, 845–850. doi: 10.1128/JCM.02441-10

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Pfaller, M.A., Messer, S.A., Boyken, L., Rice, C., Tendolkar, S., Hollis, R.J., et al. (2004). Перекрестная устойчивость между флуконазолом и равуконазолом и использование флуконазола в качестве суррогатного маркера для прогнозирования чувствительности и устойчивости к равуконазолу среди 12 796 клинических изолятов Candida spp. Дж. Клин. микробиол. 42, 3137–3141. doi: 10.1128/JCM.42.7.3137-3141.2004

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Pfaller, M.A., Messer, S.A., Boyken, L., Rice, C., Tendolkar, S., Hollis, R.J., et al. (2007). Использование флуконазола в качестве суррогатного маркера для прогнозирования чувствительности и резистентности к вориконазолу среди 13 338 клинических изолятов Candida spp. Протестировано в соответствии с клиническими и лабораторными стандартами, рекомендованными институтом методами микроразбавления бульона. Дж.клин. микробиол. 45, 70–75.

Реферат PubMed | Академия Google

Пфаллер, М. А., Мессер, С. А., Бойкен, Л., Тендолкар, С., Холлис, Р. Дж., и Дикема, Д. Дж. (2008). Выбор суррогатного агента (флуконазол или вориконазол) для первоначального тестирования чувствительности к позаконазолу против Candida spp.: результаты глобальной программы наблюдения за противогрибковыми препаратами. Дж. Клин. микробиол. 46, 551–559. doi: 10.1128/JCM.01952-07

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Пина-Ваз, с., Сансонетти Ф., Родригес А.Г., Коста-Де-Оливейра С., Мартинес-Де-Оливейра Дж. и Фонсека А.Ф. (2001). Чувствительность к флуконазолу клинических изолятов Candida определяли окрашиванием FUN-1 с помощью проточной цитометрии и эпифлуоресцентной микроскопии. J. Med. микробиол. 50, 375–382. дои: 10.1099/0022-1317-50-4-375

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Ройсс О., Вик А., Колтер Р. и Моршхаузер Дж. (2004). Флиппер SAT1, оптимизированный инструмент для разрушения генов Candida albicans . Ген 341, 119–127. doi: 10.1016/j.gene.2004.06.021

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Резаи З., Хабнадидех С., Пакшир К., Хоссаини З., Амири Ф. и Асадпур Э. (2009). Дизайн, синтез и противогрибковая активность производных триазола и бензотриазола. евро. Дж. Мед. хим. 44, 3064–3067. doi: 10.1016/j.ejmech.2008.07.012

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Родригес, К.Ф., Сильва С. и Энрикес М. (2014). Candida glabrata : обзор особенностей и резистентности. евро. Дж. Клин. микробиол. Заразить. Дис. 33, 673–688. doi: 10.1007/s10096-013-2009-3

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Родригес-Тудела, Дж. Л., Барчиези, Ф., Билле, Дж., Криссанту, Э., Куэнка-Эстрелла, М., Деннинг, Д., и др. (2003). Метод определения минимальной ингибирующей концентрации (МИК) путем разведения ферментативных дрожжей в бульоне. клин. микробиол. Заразить 9, 1–8.

Академия Google

Родригес-Тудела, Дж. Л., Доннелли, Дж. П., Пфаллер, М. А., Криссанту, Э., Уорн, П., Деннинг, Д. В., и соавт. (2007). Статистический анализ корреляции между МИК флуконазола для Candida spp. оцениваются стандартными методами, установленными европейским комитетом по тестированию чувствительности к противомикробным препаратам (E.Dis. 7.1) и CLSI (M27-A2). Дж. Клин. микробиол. 45, 109–111. doi: 10.1128/JCM.01969-06

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Ретцер, А., Гэблдон, Т., и Шуллер, К. (2011). От Saccharomyces cerevisiae до Candida glabrata за несколько простых шагов: важная адаптация условно-патогенного микроорганизма. FEMS Microbiol. лат. 314, 1–9. doi: 10.1111/j.1574-6968.2010.02102.x

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Роза М.Ф. и Са-Коррейя И. (1996).Внутриклеточное подкисление не объясняет ингибирование роста Saccharomyces cerevisiae в присутствии этанола. FEMS Microbiol. лат. 135, 271–274. doi: 10.1111/j.1574-6968.1996.tb08000.x

Полнотекстовая перекрестная ссылка | Академия Google

Санглард, Д., Ишер, Ф., Калабрезе, Д., Майчерчик, П.А., и Билле, Дж. (1999). Ген транспортера кассеты связывания АТФ CgCDR1 из Candida glabrata участвует в устойчивости клинических изолятов к азольным противогрибковым агентам. Антимикроб. Агенты Чемотер. 43, 2753–2765.

Реферат PubMed | Академия Google

Санглард, Д., Кухлер, К., Ишер, Ф., Пагани, Дж.Л., Моно, М., и Билле, Дж. (1995). Механизмы резистентности к азольным противогрибковым агентам у изолятов Candida albicans , полученных от больных СПИДом, включают специфические переносчики многих лекарств. Антимикроб. Агенты Чемотер. 39, 2378–2386. doi: 10.1128/AAC.39.11.2378

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Сангинетти, М., Постераро Б., Фиори Б., Ранно С., Торелли Р. и Фадда Г. (2005). Механизмы устойчивости к азолам у клинических изолятов Candida glabrata , собранных во время госпитального исследования устойчивости к противогрибковым препаратам. Антимикроб. Агенты Чемотер. 49, 668–679. doi: 10.1128/AAC.49.2.668-679.2005

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Сильва, А.П., Миранда, И.М., Гуида, А., Синнотт, Дж., Роча, Р., Сильва, Р., и соавт. (2011). Транскрипционное профилирование устойчивых к азолу штаммов Candida parapsilosis . Антимикроб. Агенты Чемотер. 55, 3546–3556. doi: 10.1128/AAC.01127-10

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Шведа П., Гуцва К., Романовска Э., Дзержановска-Фанграт К., Наумюк Л., Брилловска-Дабровска А. и соавт. (2015). Механизмы устойчивости к азолам среди клинических изолятов Candida glabrata в Польше. J. Med. микробиол. 64, 610–619. doi: 10.1099/jmm.0.000062

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Вермицкий, Ю.П. и Эдлинд, Т. Д. (2004). Резистентность к азолу у Candida glabrata : скоординированная активация переносчиков многих лекарственных средств и доказательства наличия Pdr1-подобного фактора транскрипции. Антимикроб. Агенты Чемотер. 48, 3773–3781. doi: 10.1128/AAC.48.10.3773-3781.2004

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Уайт, TC (1997). Повышенные уровни мРНК ERG16, CDR и MDR1 коррелируют с повышением устойчивости к азолам в изолятах Candida albicans от пациента, инфицированного вирусом иммунодефицита человека. Антимикроб. Агенты Чемотер. 41, 1482–1487.

Реферат PubMed | Академия Google

Виршинг С., Мишель С., Колер Г. и Моршхаузер Дж. (2000a). Активация гена множественной лекарственной устойчивости MDR1 у устойчивых к флуконазолу клинических штаммов Candida albicans вызывается мутациями в трансрегуляторном факторе. J. Бактериол. 182, 400–404. doi: 10.1128/JB.182.2.400-404.2000

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Виршинг, С., Мишель С. и Моршхаузер Дж. (2000b). Направленное разрушение гена в штаммах дикого типа Candida albicans : роль гена MDR1 в устойчивости к флуконазолу клинических изолятов Candida albicans . Мол. микробиол. 36, 856–865. doi: 10.1046/j.1365-2958.2000.01899.x

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Кандидоз/кандидоз/молочница у домашних птиц

Молочница (кандидоз) диагностируется при микроскопическом исследовании окрашенного (окраска по Граму) капельного мазка или мазка изо рта.Культуральный тест подтвердит тяжесть инфекции и поможет определить основную причину.

Что такое молочница?

Дрозд – распространенное заболевание домашних и других птиц. Это состояние беспокоит птицу, заставляя ее впадать в депрессию и безжизненность. У птицы с молочницей часто наблюдаются капельные изменения, потому что инфекция раздражает слизистую кишечника. Капля молочницы обычно поражает рот, заставляя птиц чрезмерно глотать. Он может даже заразить носовые пазухи и вызвать чихание.Инфекции молочницы потенциально опасны для жизни, если их оставить без присмотра.

Молочница всегда вызывается основным стрессовым фактором. К факторам стресса относятся дефицит витаминов и минералов, колебания температуры, изменение окружающей среды, психологический стресс и основное заболевание.

Как лечится молочница?

Молочница требует 5-7-дневного курса лечения микостатином. Микостатин лучше всего вводить непосредственно внутрь. Если это невозможно, лечение питьевой водой может быть эффективным.Удалите все семена, песок, семенные колокольчики и плоды из клетки. Продезинфицируйте клетку средством для очистки воды и начните выращивать птицу на стерильных семенах.

Есть ли другие специальные инструкции?

Для ускорения процесса заживления я рекомендую всем птицам, зараженным молочницей, давать Turbobooster, энергетическую добавку и Fvite на стерильных семенах ежедневно в течение трех недель, а затем три раза в неделю после этого времени. После лечения антибиотиками Dufoplus и Ioford даются два раза в неделю с питьевой водой.Убедитесь, что ваша птица действительно ест и пьет. В противном случае потребуется специальное принудительное кормление в больнице (примечание Avianweb: или кем-то, кто имеет опыт / обучен надлежащим процедурам принудительного кормления).

Есть ли долгосрочные проблемы?

Заражение молочницей может сделать вашу птицу восприимчивой к болезням в будущем. Очиститель воды добавляют в питьевую воду в течение двух дней подряд. Затем ему дают два дня в неделю, а затем Dufoplus и Ioford, чтобы помочь контролировать рецидив.Для дополнительной защиты вашей птицы от повторных инфекций следуйте программе охраны здоровья, описанной в прилагаемой брошюре.

Является ли это заболевание заразным для человека или других птиц?

Хотя молочница не очень заразна, она может передаваться от птицы человеку при тесном контакте, особенно при поцелуях. Он также может передаваться от птицы к птице через помет.

Можно ли предотвратить рецидив молочницы?

Молочница всегда связана со стрессовыми факторами.Необходимо соблюдать особую осторожность, чтобы свести к минимуму потенциальный стресс для птицы. Это может быть в форме изменения окружающей среды или корректировки питания. Следуя постоянной программе здоровья, ваша птица будет обеспечена всеми минералами и питательными веществами, необходимыми для постоянного здоровья и жизнеспособности.


Кандидоз

Заболевание, часто встречающееся у цыплят, находящихся на ручном вскармливании, — вызывается дрожжевым грибком, который чаще всего поражает зоб и пищеварительный тракт; но он также может поражать другие органы, включая дыхательную систему, клюв, кожу, перья, глаза, репродуктивные пути и центральную нервную систему.

Причина:

Кандидоз чаще всего встречается у молодых птиц, особенно у птиц, получающих антибиотики, и у взрослых птиц с ослабленной иммунной системой. Птицы, питающиеся только семенами и/или с дефицитом витамина А, находятся в группе риска. Признаки дефицита витамина А включают пятна от перьев над восковицей (мясистая область над клювом) в результате выделений из ноздрей. Также может отмечаться интенсивность окраски восковицы и/или оперения, а также ухудшение состояния общего оперения.

Наличие других инфекций, таких как поксвирус или трихомонады, вдыхание дыма, стресс или травма также предрасполагают птиц к чрезмерному росту дрожжей.

  • Витамин А способствует аппетиту, пищеварению, а также повышает устойчивость к инфекциям и некоторым паразитам.

Продукты, богатые витамином А, включают: темную листовую зелень, продукты оранжевого цвета (абрикосы, мускусную дыню, морковь, красный перец, тыкву и сладкий картофель).

Симптомы:

На культуре, зараженной Candida , видны сыроподобные поражения, вызванные серовато-белым слоем на внутренней стороне культуры.Эта мембрана часто воспаляется, в результате чего зоб выглядит опухшим.

У цыплят с инфекцией coop наблюдается вздутие или вздутие зоба, замедленное опорожнение зоба (медленный зоб) и возможная закупорка зоба; они могут страдать анорексией, а изо рта может выделяться прозрачная слизистая жидкость. Они могут срыгивать пищу.

При поражении рта и клюва можно заметить неприятный запах изо рта и приподнятые участки с густым прозрачным или белым налетом во рту; и в верхнем и нижнем клюве (чаще всего там, где они сходятся).

При поражении пищеварительного тракта птицы могут страдать от потери аппетита, потери веса, рвоты и диареи.

При инфицировании дыхательных путей могут отмечаться выделения из носа, изменение голоса, затрудненное и учащенное дыхание.

Трансмиссия:

Дрожжи обычно растут на испорченных кормах, на плохо убранных клетках; это может быть на наших руках и передаваться нашим птицам, когда мы обращаемся с ними … Для птиц из группы риска ваш ветеринар может посоветовать добавить хлоргексидин в питьевую воду.

Лечение: (прокрутите вниз, чтобы узнать, как заводчики решают эту проблему)

Лечение требует устранения любых факторов риска, таких как стресс, неправильное питание, антисанитария или наличие других заболеваний. Основное внимание следует уделять качественному питанию и поддержке иммунной функции. В рационе не должно быть сахара и фруктов до тех пор, пока не исчезнут дрожжевые грибки. В разрешении этой болезни поможет чистая окружающая среда – качественный воздух и вода (пародистилированная).

Обычно назначаемые противогрибковые препараты включают нистатин, флуцитозин, кетоконазол (низорал), флуконазол, дифлюкан и итраконазол. Для лечения оральных или кожных инфекций обычно применяют мазь, содержащую амфотерицин В.

Обратите внимание, что грибы рода Candida могут стать устойчивыми к нистатину, особенно при неправильном применении и/или в течение длительного времени.

Нистати назначают внутрь в течение 5 дней или дольше. Нистатин можно смешивать со смесью для ручного вскармливания; тем не менее, он более эффективен, если дать ему полную дозу примерно за полчаса до кормления.Предметы для питомника необходимо очищать и дезинфицировать после использования на каждой птице. Во избежание перекрестного заражения настоятельно рекомендуется не использовать какую-либо посуду для двух птиц без промежуточной дезинфекции. Любая оставшаяся формула должна быть отброшена.

Avianbiotech рекомендует следующее:

Нистатин, наиболее часто назначаемый противогрибковый препарат. Эту желтоватую жидкую суспензию обычно принимают внутрь в течение 5 дней или дольше. Нистатин можно смешивать непосредственно со смесью для ручного кормления, но он более эффективен, если дать ему полную дозировку примерно за 1/2 часа до кормления.Это даст ему время покрыть слизистую оболочку зоба и атаковать нездоровый организм Candida. Нистатин работает, разрушая клеточные стенки грибов. Нистатин плохо всасывается в желудочно-кишечном тракте. Это противогрибковое средство не следует использовать без разбора или в качестве профилактического средства. Candida может стать резистентной к нистатину при длительном применении, из-за неадекватных или неправильных режимов дозирования. Не думайте, что птица, обработанная нистатином, избавится от Candida. Некоторым резистентным дрожжевым грибкам требуются противогрибковые препараты, отличные от нистатина.

Дифлюкан, один из новейших препаратов, доказал свою эффективность при лечении грибковых инфекций. Было обнаружено, что суспензия, сочетающая нистатин и дифлюкан, является безопасным и эффективным средством для лечения Candida. Candida у корелл может оказаться чрезвычайно трудно поддающейся лечению. При правильном применении Дифлюкан может вылечить кандидоз в течение пяти дней.

Кетоконазол (торговое название Низорал), который принимается перорально, иногда назначают при развитии резистентных к нистатину штаммов Candida.Он почти нерастворим в воде, дорог и может быть токсичным при неправильном использовании. Использование Низорала на тяжелобольной и физически напряженной птице может привести к летальному исходу. Низорал следует применять под ветеринарным наблюдением, только у физически «здоровых» птиц, для лечения дрожжевой инфекции или в качестве профилактики при применении антибиотикотерапии.

Флуцитозин — 250 мг/кг перорально два раза в день x 21 день

Кетоконазол — 10-30 мг/кг два раза в день x 21 день

Флуконазол — 5 мг/кг один раз в сутки в течение 7 дней

Нистатин — 100 000 ЕД 1 мл на 400-граммовую птицу перорально 2 раза в день x 7 дней

Натуральное лечение / обработка цыплят и взрослых особей дрожжами


(проконсультируйтесь с ветеринаром) Сырой яблочный уксус:
  • Некоторые заводчики клянутся сырым яблочным уксусом, и их рекомендации заключаются в том, чтобы добавить одну или две капли сырого яблочного уксуса в смесь для ручного кормления, чтобы установить нормальный баланс pH в кишечнике.Яблочный уксус естественным образом повышает кислотность в пищеварительной системе, тем самым способствуя росту здоровой бактериальной флоры… Уксус: естественный подход к содержанию птиц ( ПОЖАЛУЙСТА, ОБРАТИТЕ ВНИМАНИЕ: НАГРЕВАННЫЙ уксус выделяет токсичные пары, похожие на углекислый газ. Владельцы птиц потеряли домашних животных, добавляя уксус в цикл мытья посуды или используя его для чистки кофемашин. )
  • Органический яблочный сидр содержит натуральные ферменты, минералы, витамины и незаменимые кислоты, которые помогают держать дрожжи под контролем.Его часто называют природным «антибиотиком», который является скорее пробиотиком (потому что это антисептик). Разбавление, рекомендованное заводчиком, составляло примерно 1/4 стакана уксуса на один галлон дистиллированной или фильтрованной воды. (Не используйте родниковую воду, так как она может противодействовать действию некоторых ферментов). ПРИМЕЧАНИЕ. Некоторые птицы могут быть чувствительны к уксусу, поэтому обязательно поговорите со своим ветеринаром, прежде чем начинать использовать этот или любой другой режим естественного происхождения.
  • Один ветеринар рекомендовал следующую дозировку для раннего лечения или профилактики кандидоза: 1 чайная ложка яблочного уксуса на 16 унций воды.
  • При дрожжевых инфекциях на коже смочите ватную палочку в уксусе и применяйте каждый день в течение примерно трех недель. Обычно это проясняет ситуацию.

Экстракт семян грейпфрута (GSE)

  • Другие (включая меня) были довольны результатами, полученными при добавлении экстракта семян грейпфрута (GSE) в смесь для ручного кормления. Я использую его в качестве профилактической меры, и он буквально устранил эту проблему. В качестве дополнительного преимущества GSE также обладает хорошими антипаразитарными свойствами.

Пробиотики:

Лечение горечавкой фиолетовой:

  • Gentian Violet считается безопасным и эффективным средством для лечения Candida, и оно было успешным, когда традиционное лечение не помогло. Его можно приобрести в некоторых аптеках и у поставщиков оборудования для ручного кормления. Раствор 1% горечавки фиолетовой применяют для промывания рта, пищевода и зоба у птиц, страдающих болезнью зоба. Пропитанный тампон медленно вращают вокруг рта, вниз по пищеводу и в зоб.Убедитесь, что полностью протрите внутреннюю часть урожая фиолетовым Gentian Violet. Это помогает приложить большой палец к зобу и провести тампоном круговыми движениями по зобу, слегка надавливая на большой палец. Здоровая ткань в зобе будет окрашиваться в пурпурный цвет при обработке мазком Gentian Violet. Нездоровая ткань будет выглядеть беловатой и пятнистой. Наилучшие результаты достигаются при введении в пустой зоб, но пустой зоб или эвакуация зоба не являются абсолютно необходимыми, если только зоб не заполнен более чем на ½.Лечение следует проводить каждое утро или через утро, в зависимости от тяжести инфекции, в течение трех дней. Очень редко лечение продолжается более трех дней, за исключением тяжелых случаев. Улучшение должно быть очевидным ко второй процедуре. Беловатые поражения на стенке зоба начнут исчезать. Когда все очаги исчезнут, лечение можно прекратить. В случае вздутия урожая урожай заметно сдуется. Это проверенное лечение очень безопасно, и удовлетворительные результаты часто достигаются почти сразу.Если это трехдневное лечение не показывает улучшения, настоятельно рекомендуется посетить ветеринара.

Рекомендации заводчиков:


Обязательно прочитайте мнения Патриции и Хайке о нистатине. Используйте свое собственное суждение о том, как бороться с дрожжами. Также стоит прочитать «Естественное лечение дрожжей» Хелены и Марти.

Использование нистатина для борьбы с дрожжами Хайке Юинг

Нистатин является одним из самых безопасных «лекарств» на рынке. При пероральном введении нистатин остается в пищеварительном тракте; он не проникает через мембранный барьер в кровеносную систему и, в отличие от системных противогрибковых средств, таких как итранконазол или флуконазол, не влияет на какие-либо внутренние органы или системы.Кроме того, нистатин является «контактным» препаратом, который взаимодействует с живыми дрожжевыми организмами, с которыми он вступает в непосредственный контакт, и убивает их. Он ничего не делает с другими тканями или клетками. В прошлом я случайно давал большие передозировки нистатина очень молодым цыплятам без каких-либо побочных эффектов.

— Следовательно, нистатин является безопасным и очень эффективным противогрибковым средством при дрожжевых инфекциях зоба или желудочно-кишечного тракта, который можно безопасно давать цыплятам любого возраста и родителям, которые несут, насиживают или кормят цыплят.Правильная дозировка зависит от концентрации раствора, но дозировка, которую я указал для «стандартной» суспензии, которая есть в большинстве аптек и ветеринаров, составляет 0,3 мл на 100 г массы тела каждые 12 часов в течение 7–10 дней. Для достижения наилучших результатов давайте дозу, когда зоб пуст, выполняйте массаж зоба после того, как дано лекарство, и не кормите цыпленка в течение 10-15 минут после его дачи.

— Я слышал, как другие выражали озабоченность по поводу нистатина в прошлом, и специально расспрашивал об этом моего ветеринара по птицам; она объяснила, что, по ее мнению, люди путаются между нистатином и другими противогрибковыми препаратами, поскольку большинство «азольных» противогрибковых препаратов являются мощными системными препаратами, которые могут иметь серьезные побочные эффекты и могут вызывать врожденные дефекты и другие проблемы, если их давать птицам, откладывающим яйца.Нистатин — это совершенно другой тип препарата, и у него нет ни одной из этих проблем — на самом деле, хотя генцианвиолет может быть более эффективным при тяжелых кандидозных инфекциях сельскохозяйственных культур, он более опасен, чем нистатин, и с большей вероятностью убьет цыплят при неправильном применении, даже если это безрецептурный продукт.

— За 9 лет, что я занимаюсь разведением корелл, нистатин был моей ПЕРВОЙ линией защиты от дрожжевых инфекций сельскохозяйственных культур, и у меня никогда не было проблем с ним и я никогда не терял цыплят из-за его использования.Единственным его недостатком является то, что он совершенно неэффективен против системных грибковых инфекций, и что для устранения тяжелых инфекций требуется много времени, потому что он убивает только верхний слой дрожжевых клеток — те, с которыми он вступает в непосредственный контакт — каждый раз, когда его дают. .

ПРИМЕЧАНИЕ: Марти Лаустер отметила: «Неудачи нистатина связаны как с устойчивыми штаммами, так и с тем фактом, что это местное лекарство должно вступать в непосредственный контакт с организмами, которые оно атакует.Если дрожжевые грибки стали системными и больше не содержатся только в пищеварительном тракте, нистатин не окажет никакого действия. Каприловая кислота действует системно, поэтому она может попасть в дрожжевые грибки, разросшиеся во внутренние органы.»

Вклад Патриции Картер о нистатине для борьбы с дрожжами

Я бы не рекомендовал использовать нистатин, не зная, существует ли на самом деле проблема с дрожжами. Даже если бы я знал, что дрожжи присутствуют, я бы сначала попробовал пробиотики, поскольку они не имеют побочных эффектов, таких как химические вещества в нистатине.Генцианвиолет также хорошо действует на дрожжи. Я бы использовал нистатин в качестве последней линии защиты.

Контроль дрожжей естественным путем от Helena / Totally Tweety

Хелена использует непастеризованный, нефильтрованный, органический и сырой яблочный уксус. 1 ч.л. на пинту воды. Она использует бренд под названием «Древо жизни». Яблочный уксус решает большинство проблем с грамотрицательными и дрожжевыми грибками без лекарств. Применяет ее при проблемах с урожаем, по 2 ст. на 1 галлон воды. Доктор Харрисон советует использовать в течение 1 недели каждые 3 месяца для профилактики.Это иммуностимулятор. Он также содержит ряд полезных витаминов и минералов.

Использование яблочного уксуса, эффективного против дрожжей и бактерий
Сафией

Одним из способов борьбы с дрожжами является добавление в воду попугаев яблочного уксуса. Я готовлю по галлону за раз и храню в холодильнике. Всего 2 столовые ложки ЯБЛОЧНОГО УКСУСА (не белого или любого другого) на галлон. Я попробовал Кокомо, чтобы узнать, что она предпочитает: воду с уксусом или простую воду.Она каждый раз идет за уксусной водой. Ей это нравится, не знаю почему… Что-то в уксусе борется с дрожжами и другими вредными бактериями.

ОБРАТИТЕ ВНИМАНИЕ: НАГРЕВАННЫЙ уксус выделяет токсичные пары, подобные углекислому газу. Владельцы птиц потеряли своих питомцев, добавляя уксус в цикл мытья посуды или используя его для чистки кофемашин.

Другое натуральное средство от дрожжей у птенцов от:
Martie Lauster

Успешно использовано Каприловая кислота для спасения цыпленка, у которого были признаки дрожжевого грибка: он срыгивал пищу, имел покраснение вокруг горла, зоба и рта , и к приручению Марти обнаружила, что ребенок лежит на боку, выглядя так, как будто он «на пути к выходу».Как бы то ни было, Марти купила продукт под названием «Комбинация каприловой кислоты». Марти подобрал дозировку (примерно 1/8 чайной ложки на одну десертную ложку сухой смеси) и насильно скормил ее ребенку. Два часа спустя Марти снова пришлось кормить насильно, так как ребенок все еще не проявлял никакого интереса к еде. Через четыре часа ребенок стал гораздо более отзывчивым, а к восьми часам уже вставал и кричал, чтобы его покормили! Это было похоже на чудо. Марти продолжала ту же дозировку в течение следующих трех дней, и маленькая сова полностью выздоровела, прыгает и здорова.

ПРИМЕЧАНИЕ: У некоторых птиц каприловая кислота вызывает расстройство желудка. Так что имейте в виду, что если и когда администрирование его.

Кроме того, люди советовали Марти давать алоэ , чтобы смягчить воздействие токсинов, вырабатываемых дрожжами. Марти обнаружила у этого ребенка и у других, что алоэ дает медленный урожай и, по-видимому, успокаивает воспаление, вызванное дрожжевой инфекцией. Марти, несомненно, будет использовать каприловую кислоту и алоэ в будущем, чтобы попытаться справиться с лучшими приложениями.

Некоторые владельцы птиц настоятельно рекомендуют следующий продукт с алоэ: Марти использует продукт под названием Herbal Aloe Force, но другие используют Aloe Detox с аналогичными результатами. Производитель сообщает, что Aloe Detox необходимо хранить в холодильнике (очевидно). После вскрытия хранится от 7 до 9 месяцев. Одним из рекомендуемых брендов является «Формула для детоксикации алоэ с алоэ в пустыне», которую можно приобрести в магазинах здоровой пищи или в Интернете.


Предотвращение:

Риск кандидоза можно значительно снизить, обеспечив санитарные условия и правильное питание, уменьшив или устранив любые причины стресса и предотвратив контакт с любой потенциально больной птицей.Основные санитарные процедуры включают в себя удаление старой пищи из крыльев или клеток, чистую воду и обеспечение иммуностимулирующим питанием. Поддержание общего уровня гигиены при обращении с новорожденными и ручном воспитании поможет предотвратить заражение молодых птиц этой болезнью. Ненужная и чрезмерная антибиотикотерапия увеличивает риск грибковых инфекций.


Другие соответствующие веб-ресурсы


НУЖЕН ВЕТЕРИНАР?
США:
Найдите местного ветеринара по птицам

Информация, содержащаяся на этом веб-сайте, предназначена только для общего ознакомления.Для применения в конкретных обстоятельствах следует обратиться за профессиональной консультацией.


BeautyOfBirds стремится поддерживать точную и актуальную информацию; однако ошибки случаются. Если вы хотите исправить или обновить какую-либо информацию, пожалуйста, отправьте нам письмо по электронной почте! СПАСИБО!

.

Написать ответ

Ваш адрес email не будет опубликован.


Среднее Станд. отклонение Среднее различие -value значение

Хлоргексидин 20 21,80 8,458 -0,5 -0,611 0,542
Кетоконазол 20 Тест Манна-Уитни.

90 406 Кокосовое масло

Среднее 4 отклонение Среднее различие -value значение
20 16,80 12,846 -5,5 -1,761 0,078
Кетоконазол 20 22.30 15.076

Тест Манна-Уитни.
22,30 15,076

Среднее 4 отклонение Среднее различие -value значение

Пробиотики 20 13,50 13,656 -8,8 -2.272 0,023
Кетоконазол 20

тест Манна-Уитни.
4. Обсуждение

Высокая распространенность подслащенных веществ в рационе детей, сопровождающаяся плохой гигиеной полости рта, наличием кариеса, длительным использованием бутылочек для кормления и пустышек, являются основными факторами, связанными с высокой распространенностью С.albicans у детей. Место наивысшей колонизации для C. albicans обеспечивается кариозным поражением, поскольку оно обеспечивает экологическую нишу для этого микроорганизма [10].

Кетоконазол представляет собой противогрибковое соединение имидазола, обладающее значительной активностью в отношении широкого спектра поверхностных и системных инфекций, вызываемых патогенными дрожжами, дерматофитами и нитчатыми грибами, включая C. albicans . Стимулирует фагоцитоз и ингибирует рост филаментов C.albicans [11]. Основным местом действия кетоконазола является ингибирование дыхания 90–198 C. albicans 90–199 за счет ингибирования активности НАДН-оксидазы на митохондриальном уровне [12]. Он вызывает прямое повреждение мембран клеток C. albicans и ингибирование биосинтеза эргостерола, который является характерным компонентом клеточных мембран дрожжей. Следовательно, в настоящем исследовании кетоконазол принят в качестве стандартного противогрибкового средства, против которого тестируются другие противомикробные средства.

Хлоргексидина диглюконат используется в качестве антисептика широкого спектра действия, часто включаемого в полоскания рта. Обладает широким спектром активности в отношении различных организмов, в том числе 90–198 C. albicans 90–199 [13]. Биопленки на поверхностях полости рта (зубной налет) являются причиной кариеса и заболеваний пародонта. Хлоргексидин способен ингибировать адгезию кандидоза к биологическим и инертным поверхностям [14]. Он действует как фунгицид и обладает фунгистатической функцией, приводящей к коагуляции нуклеопротеинов и изменениям в клеточных стенках, позволяющим возможному выходу компонентов цитоплазмы через плазмалемму [15].В настоящем исследовании хлоргексидин показал значительную антимикробную активность в отношении C. albicans со средней зоной ингибирования 21,8 мм, а разница с таковой для кетоконазола не была статистически значимой (значение 0,54). В аналогичном исследовании Machado et al. [13] растворы хлоргексидина показали снижение колониеобразующих единиц биопленки Candida .

Известно, что кокосовое масло проявляет антимикробную активность в отношении S. mutans и C.albicans [16]. Он играет уникальную роль в рационе как важная физически функциональная пища и состоит из жирных кислот со средней длиной цепи. Он содержит 92 % насыщенных жирных кислот, примерно 50 % из которых приходится на лауриновую кислоту [17]. Показано, что монолаурин и другие моноглицериды со средней длиной цепи обладают способностью изменять стенки микробных клеток, проникать и разрушать клеточные мембраны, а также ингибировать ферменты, участвующие в производстве энергии и переносе питательных веществ, что приводит к гибели бактерий [18]. Бергссон и др.показали чувствительность Candida albicans к нескольким жирным кислотам и их 1-моноглицеридам [19]. В настоящем исследовании кокосовое масло показало противогрибковую активность, сравнимую с активностью кетоконазола. Было обнаружено, что C. albicans очень чувствителен к кокосовому маслу в аналогичном исследовании, проведенном Ogbolu et al. [20]. Также известно, что кокосовое масло вызывает значительное уменьшение гингивита, что можно объяснить уменьшением накопления зубного налета и противовоспалительным, смягчающим действием кокосового масла [21].

Согласно отчету ВОЗ/ФАО (2002 г.), пробиотики представляют собой «живые микроорганизмы, которые при введении в адекватных количествах приносят пользу здоровью хозяина». Использование пробиотиков и молекулярной генетики для замены и вытеснения кариесогенных бактерий некариесогенными бактериями дало многообещающие результаты. Хатакка и др. [22] показали снижение распространенности C. albicans после приема пробиотиков в сыре. Результаты, полученные Kõll et al. [23] заметно отличались, где сообщалось, что рост 90–198 C.albicans не ингибировался пробиотиками. В настоящем исследовании было обнаружено, что пробиотики ингибируют рост C. albicans . Однако он был меньше, чем у хлоргексидина и кокосового масла. Разница в зоне ингибирования с кетоконазолом была статистически значимой.

5. Заключение

Это исследование научно доказывает противогрибковую активность хлоргексидина, кокосового масла и пробиотиков. Установлено, что противогрибковая активность кокосового масла выше, чем у пробиотиков в отношении 90–198 C.альбиканс . Необходимо провести дальнейшие исследования для определения антимикробной эффективности, МПК и МФХ этих агентов, а также провести дополнительные клинические исследования для их подтверждения.

Конкурирующие интересы

Авторы сообщают об отсутствии конкурирующих интересов.

Молочница – советы по уходу за ребенком

Молочница — это грибковая инфекция, которая может поражать ротовую полость ребенка, область под подгузником и грудь кормящей матери. В некоторых случаях это может быть трудно лечить.Узнайте о признаках молочницы, о том, как ее предотвратить, и о различных медицинских и немедицинских методах лечения.

Что такое молочница?

Другие названия молочницы включают: дрожжевую инфекцию; грибковая инфекция; Кандида; Кандидоз; или монилиоз. Эти вариации в названиях возникают из-за того, что термин «молочница» используется для описания разрастания штамма дрожжеподобного грибка под названием «Candida Albicans» .

Младенцы , а не рождаются с этими дрожжами в своем теле и контактируют с ними только от других.Подсчитано, что 90% детей будут иметь эти дрожжи на теле и/или в организме к тому времени, когда им исполнится 6 месяцев.

Что касается остальных из нас, почти каждый переносит эти дрожжи на своем теле или в нем. Для большинства из нас он вполне счастливо живет во влажных областях, таких как наш кишечник, рот, кожные складки, влагалище и пах, и мы обычно не испытываем от него никаких проблем.

Однако при определенных условиях популяция дрожжей может взорваться и вызвать инфекцию, например…

  • прием антибиотиков или стероидов;
  • прием антацидов;
  • прием оральных контрацептивов;
  • недостаточный отдых;
  • употребление большого количества сладкой пищи;
  • стресс;
  • аллергии;
  • травма сосков из-за плохого захвата груди во время кормления грудью;
  • поврежденная кожа из-за опрелостей.

Маленькие дети более уязвимы для молочницы, чем взрослые, из-за незрелости их иммунной системы. Это означает, что их организм не может ограничивать рост этих дрожжей так же эффективно, как взрослые, и может возникнуть инфекция. Одна из причин, по которой нужно очень внимательно относиться к гигиене при уходе за очень маленьким ребенком, заключается в том, чтобы как можно дольше не подвергать его/ее воздействию этих дрожжей.

Является ли молочница серьезной проблемой?

Для здоровых, развивающихся детей молочница – это незначительное неудобство, которое может вызывать легкий дискомфорт, в отличие от сильной боли, которую может испытывать кормящая мать, если молочница развивает молочницу.

Молочницу часто обвиняют в сложном поведении, таком как раздражительность, бессонница и проблемы с кормлением, однако молочница редко является причиной такого поведения у здоровых детей. (См. плач ребенка и младенческие колики, чтобы узнать о частых причинах такого поведения.)

Молочница может быть серьезной проблемой для младенцев и взрослых с ослабленным иммунитетом, то есть с очень слабо функционирующей иммунной системой.

Молочница во рту у младенцев

Если у ребенка молочница во рту, есть вероятность, что у него также может развиться дрожжевая инфекция на его маленьком заднике, потому что дрожжевые грибки могут пройти изо рта через желудочно-кишечный тракт.

Признаки стоматита
  • Пятна белого или кремового цвета, похожие на творог, можно увидеть на нёбе, внутренней поверхности щек и на языке. Они могут быть окружены красными участками, или весь его язык может иметь сплошной белый налет*.
  • Суетливое, неуравновешенное поведение во время кормления (из-за боли во рту) встречается редко и, как правило, возникает только при тяжелом течении инфекции, т. е. если инфекция достигает стадии образования язв (что редко встречается у здоровых детей, даже если молочницу не лечат).
  • Если ваш ребенок сосет большой палец или пальцы, у него также может развиться дрожжевая инфекция вокруг ногтей.

* Остатки молока, оставшиеся после кормления, часто принимают за молочницу. Остатки молока обычно обнаруживаются только на языке. Он тонкий и легко вытирается или полоскается изо рта.  

Лечение молочницы полости рта
  • Кипятить пустышки, приспособления для кормления, зубные кольца и т. д. в течение 5–7 минут после каждого использования, пока присутствует инфекция.
  • Игрушки, которые ваш ребенок (или другие дети) может грызть, следует мыть в горячей мыльной воде и либо регулярно отбеливать, либо сушить на солнце.
  • Прополощите рот ребенка после кормления. Несколько глотков воды из аптечки помогут удалить молоко изо рта. (Остаток молока способствует росту этих дрожжей).
  • Часто мойте руки ребенка теплой водой с мылом.
  • Используйте натуральное средство или противогрибковый препарат, как описано ниже.Если используется лекарство, промывайте пипетку в горячей мыльной воде после каждого использования.

Если у вашего ребенка кандидозный стоматит, следует проявлять особую осторожность, чтобы избежать развития кандидозной сыпи от подгузников (которая часто возникает поверх других опрелостей от подгузников). Если ваш ребенок находится на грудном вскармливании, вам также необходимо одновременно обрабатывать соски, чтобы снизить риск заражения молочницей на сосках или в груди.

Молочница от подгузников (подгузников)

Дрожжи, вызывающие молочницу, процветают в теплой и влажной среде.Это делает область подгузника вашего ребенка вероятным местом для заражения молочницей. Молочница может вызвать сыпь на половых органах, ягодицах или бедрах вашего ребенка.

Признаки молочницы в области подгузника

Дрожжевая опрелость ярко-розового или красного цвета с четко очерченными краями. Возле края могут быть небольшие красные пятна. Молочница кожи делает , а не белые пятна, как молочница во рту.

Профилактика и лечение молочницы, опрелостей.
  • Меняйте подгузники, как только узнаете, что они мокрые или грязные.
  • Мойте руки с мылом до и после смены подгузников.
  • Следите за тем, чтобы дрожжевые грибки, которые могут попасть на ваши руки (когда вы меняете подгузник ребенка), не попали обратно в кремы от опрелостей.
  • При наличии сыпи избегайте использования салфеток для подгузников (которые могут вызвать жжение).
  • После намокания подгузника осторожно очистите кожу ребенка водой с уксусом или раствором пищевой соды (описано ниже в разделе «Природные средства правовой защиты»). Всегда очищайте область подгузника девочки спереди назад.
  • После испражнений сначала очистите его, а затем погрузите его зад в небольшую ванну с небольшим количеством пищевой соды (описано в разделе «Природные средства правовой защиты» ниже).
  • Высушите кожу (избегайте трения).
  • Позвольте его ягодицам как можно больше проветриваться, предоставляя время без подгузника 3-4 раза в день.
  • Избегайте использования кукурузного крахмала или вазелина на его ягодицах, так как они могут стать источником пищи для дрожжей.
  • Если вы используете тканевые подгузники, дрожжи могут пройти через белье.Внимательно следуйте инструкциям по раствору для замачивания подгузников перед стиркой (можно приобрести в супермаркете). Тканевые подгузники стирайте в максимально горячей воде. Добавьте 1/2 стакана уксуса при последнем ополаскивании и высушите на солнце. Если сушка на солнце невозможна, используйте самую горячую настройку сушилки для белья.
  • Сыпь на подгузниках при молочнице может не исчезнуть при обычном лечении опрелостей, и вам может потребоваться использовать натуральное средство или противогрибковый препарат для лечения опрелостей, как описано ниже.

Молочница сосков/молочница

Поскольку у вашего ребенка могут быть дрожжи во рту (даже если у него нет никаких симптомов инфекции), любое повреждение ваших сосков во время грудного вскармливания, такое как ссадина или небольшая трещина, может увеличить вероятность развития дрожжевой инфекции в молочных протоках груди.

Хотя молочница на сосках или в груди может быть болезненной, она не должна влиять на вашу способность кормить ребенка грудью.

Признаки сосков/молочницы
  • Необычно розовые или красные соски.
  • Кожа может шелушиться (но не всегда).
  • Трещины или кровоточащие соски.
  • Стреляющая боль в груди во время кормления или может начаться через 10–15 минут после окончания кормления.
Лечение молочницы сосков/молочных желез
  • Вашего ребенка необходимо лечить от кандидоза ротовой полости, даже если у него нет симптомов, чтобы избежать распространения инфекций.
  • Тщательно мойте руки до и после кормления грудью, а также после нанесения крема на соски.
  • Убедитесь, что ребенок правильно сосет грудь, чтобы избежать дальнейшего повреждения сосков. (Дополнительную информацию о прикладывании см. в разделе Основы грудного вскармливания).
  • Старайтесь, чтобы ваши соски были как можно более сухими, потому что влага способствует росту дрожжей. Держите грудь на воздухе как можно дольше. Если вы можете подвергать соски воздействию солнечных лучей, до 10 минут два раза в день.
  • Надевайте чистый бюстгальтер каждый день или чаще
  • Меняйте прокладки для груди после каждого кормления.
  • Бюстгальтеры и многоразовые прокладки для груди следует замочить в растворе отбеливателя перед стиркой в ​​горячей воде и высушить на солнце или в сушилке при высокой температуре.
  • Грудное молоко, сцеженное во время активной дрожжевой инфекции молочных желез, следует либо использовать в течение 24 часов, либо выбросить. Замораживание не убивает дрожжи. (Использование сцеженного молока в более поздние сроки может привести к повторному заражению рта вашего ребенка.)
  • Стерилизуйте оборудование для сцеживания, которое вступает в непосредственный контакт с вашей грудью или молоком, путем кипячения или прокалывания.
  • Лечение вагинальной инфекции при необходимости.
  • Используйте натуральное средство или противогрибковый препарат, как описано ниже.
  • Перед кормлением аккуратно смойте остатки лекарств с сосков.

Если прокладки для груди прилипают к соскам, смочите их, прежде чем снимать, чтобы избежать дальнейшего повреждения. Если ваши соски настолько болят, что вам больно носить одежду, накладки на грудь* (не то же самое, что накладки на соски), которые можно приобрести в аптеке или аптеке, могут обеспечить некоторое утешение.Они размещаются внутри бюстгальтера, чтобы защитить что-либо от натирания или прилипания к соскам.

Если противогрибковое лечение не помогло облегчить симптомы в течение нескольких дней, обратитесь к врачу. Жгучая боль в груди также может быть вызвана бактериальной инфекцией, и вам могут потребоваться антибиотики.

* Накладки для груди предназначены для того, чтобы ничто не касалось нежных сосков. Куполообразная форма собирает молоко, которое может вытечь из груди.  

Лечение

Не полагайтесь только на лекарства для контроля дрожжевой инфекции у вашего ребенка.Если источник инфекции не устранен, либо инфекция не исчезнет, ​​либо кандидозная инфекция, вероятно, вернется, как только противогрибковое лечение будет прекращено.

Поскольку у маленьких детей незрелая иммунная система, наряду с лечением необходимо принять дополнительные меры, чтобы уменьшить воздействие на ребенка этих дрожжей до тех пор, пока его иммунная система не созреет достаточно, чтобы контролировать их, как правило, в возрасте около 6 месяцев. (Пока ваш ребенок находится в подгузниках, он по-прежнему подвержен риску развития молочницы от подгузников.)

Поскольку Candida albicans в конечном итоге станут обитателями тела вашего ребенка (так же, как и для большинства людей), если дрожжевая инфекция протекает в легкой форме, это означает, что его иммунная система работает достаточно хорошо, чтобы контролировать инфекцию. и противогрибковые препараты могут не понадобиться. Часто все, что нужно, — это уменьшить воздействие в дополнение к использованию натуральных средств, чтобы сделать окружающую среду (рот или кожу) менее благоприятной для роста дрожжей.

Независимо от того, используете ли вы натуральное средство или противогрибковый препарат, важно попытаться исключить источник инфекции вашего ребенка. Поскольку дрожжевые грибки, вызывающие молочницу, не всегда видны, их можно легко носить на руках, приспособлениях для кормления, подгузниках или одежде. Чтобы помочь избавиться от дрожжевого грибка (который не всегда виден), вы найдете основные рекомендации в каждом разделе выше и более экстремальные рекомендации для « Когда кажется, что молочница не проходит» ниже.

Если вы не уверены, нужны ли вашему ребенку лекарства от молочницы, обратитесь к детскому врачу, и он/она посоветует, необходимо ли лечение.

Натуральные средства

Ацидофильные и бифидофилы

Употребление натурального йогурта или прием ацидофильных капсул поможет заселить ваш организм ацидофильными молочнокислыми бактериями (хорошими бактериями, которые помогут контролировать дрожжевые грибки в пищеварительной системе).

Поскольку пищеварительная система младенцев более чувствительна, детям до года рекомендуется бифидофил, а не ацидофилин.Bifidum естественным образом встречается в кишечной флоре человека, в том числе младенцев.

Экстракт косточек грейпфрута (не экстракт косточек винограда)

Экстракт семян грейпфрута, также известный как масло семян грейпфрута, представляет собой противомикробное соединение широкого спектра действия, изготовленное из семян и мякоти грейпфрута.

Приготовьте раствор, добавив 5 капель экстракта грейпфрута в 1/2 стакана охлажденной кипяченой воды. Его можно разделить на два контейнера; один для протирания рта вашего ребенка после кормления с помощью ватного тампона (его также можно использовать для сосков после кормления грудью), другой можно использовать для мытья попки вашего ребенка при каждой смене подгузника.Используйте этот раствор по крайней мере 3 или 4 раза в день и ежедневно готовьте свежий раствор.

ПРЕДУПРЕЖДЕНИЕ.  Не используйте экстракт семян грейпфрута в концентрированной форме.

Масло чайного дерева

Масло чайного дерева — это эфирное масло, хорошо известное своими антисептическими, противовирусными и антибактериальными свойствами. Это также хорошо для борьбы с дрожжевыми инфекциями, такими как молочница. При молочнице ополаскивайте попку ребенка разбавленным маслом чайного дерева – 5 капель на 1/2 стакана охлажденной кипяченой воды.Его также можно наносить на соски и вытирать перед кормлением.

ПРЕДУПРЕЖДЕНИЕ. Масло чайного дерева может вызывать сильное раздражение, и его не следует использовать в концентрированной форме.

Уксус

Другие природные средства включают использование уксуса или пищевой соды (бикарбоната натрия) для изменения кислотного баланса окружающей среды, что делает ее менее привлекательной для роста дрожжей.

Приготовьте раствор из 1 чайной ложки белого уксуса на 1 стакан воды. (Поместите раствор в отдельные контейнеры, если вы планируете использовать его для рта и дна вашего ребенка).Используйте ватный тампон, чтобы протереть раствором рот ребенка после кормления. Его также можно использовать на сосках после грудного вскармливания. Отдельную часть этого раствора можно использовать для подмывания при смене подгузника.

ПРЕДУПРЕЖДЕНИЕ. Этот раствор может вызвать жжение, если молочница тяжелая.

В прачечной: Налейте одну чашку белого уксуса при последнем полоскании тканевых подгузников или одежды.

Пищевая сода (бикарбонат натрия)

Растворите чайную ложку пищевой соды без горки в 1 стакане воды.Используйте ватный тампон, чтобы протирать внутреннюю часть щек, десен и языка вашего ребенка после каждого кормления. Вы также можете нанести его на соски после кормления. Готовьте свежий раствор каждый день.

Грибковая сыпь от подгузников:  Вы можете использовать отдельное зелье из того же раствора, что и выше, в качестве промывания во время смены подгузников, или вы можете добавить 2 столовые ложки пищевой соды на пару дюймов воды в небольшой ванне, чтобы отмочить попку вашего малыша. на несколько минут. Обычно это очень успокаивает.

Другие природные средства, используемые только для лечения
материнской молочницы, включают:
ЧЕСНОК

Одним из многих целебных свойств чеснока является его способность убивать дрожжи, бактерии и другие микроорганизмы. Используйте его в своей кулинарии. Чесночные капсулы без запаха можно приобрести в магазинах здоровой пищи.

МОЛОЧНАЯ КИСЛОТА

Молочная кислота неблагоприятна для многих форм дрожжей и бактерий, таких как candida albican . Это относительно новый продукт, который сейчас можно приобрести в аптеках или аптеках.Смывка (только для наружного применения) содержит молочную кислоту, которая помогает поддерживать естественный баланс pH в области влагалища.

САХОМИКЕТЫ БУЛАРДИИ

Подобно лактобациллам, он также помогает сбалансировать полезные микроорганизмы в кишечной флоре.

КАПРИЛОВАЯ КИСЛОТА

Было показано, что эта жирная кислота, полученная из кокосового масла, обладает противогрибковыми свойствами.

ОЛИВКОВОЕ МАСЛО

Оливковое масло содержит линолевую кислоту, которая обладает противогрибковым действием и может препятствовать снабжению дрожжей кислородом.

ЧЕРНЫЙ ОРЕХ

Зеленая скорлупа грецкого ореха перерабатывается в масло, обладающее антимикробными свойствами. Черный грецкий орех также используется для лечения молочницы и может применяться внутрь или наружно. Черный орех следует принимать внутрь , а не , если вы кормите грудью, потому что он может остановить лактацию.

ЧАЙ ПО Д’АРКО

Пау д’Арко — южноамериканское дерево, устойчивое к росту грибков. Считается, что чай По д’Арко или Тахибо обладает естественными фунгицидными свойствами.Пить по 2-3 чашки в день.

ЗОЛОТАЯ ПЕЧАТЬ

Натуральный противомикробный препарат растительного происхождения. Goldenseal можно наносить на кожу в виде припарки, но следует принимать , а не внутрь.

ПРЕДУПРЕЖДЕНИЕ. Тот факт, что продукт является «натуральным», не означает, что он не имеет побочных эффектов. Многие натуральные средства , а не подходят для использования у младенцев, маленьких детей или кормящих матерей. Внимательно прочитайте инструкции и задайте много вопросов в магазине здоровой пищи. Если вы сомневаетесь, не используйте лечебные травы.

Лекарства 

Многие противогрибковые препараты можно приобрести без рецепта, в то время как некоторые более сильнодействующие формы требуют рецепта врача. Противогрибковые препараты выпускаются в виде капель или геля для лечения молочницы полости рта и кремов для лечения молочницы на коже, то есть на сосках и ягодицах.

Если вы принимаете лекарства, отпускаемые без рецепта, и после недели лечения молочница не проходит, обратитесь к врачу.

ВАЖНО: Обычно рекомендуется продолжать лечение в течение 1 недели после того, как инфекция исчезнет, ​​чтобы снизить риск рецидива.

Нистатин (Микостатин®, Нилстат®)

Нистатин является наиболее часто используемым средством для лечения дрожжевой инфекции. Хотя нистатин является одним из наименее токсичных известных препаратов, он эффективен примерно в 60% случаев.

В отличие от других лекарств, которые действуют при проглатывании, мистатин действует только на поверхности, к которым он может прикасаться. Поэтому очень важно, чтобы нистатин наносился непосредственно на пораженный молочницей участок, а не просто попадал ребенку в рот.

При лечении пероральной суспензией нистатина важно хорошо встряхнуть флакон перед использованием.Поместите небольшое количество (один миллилитр) в маленькую чашку. Используйте ватный тампон, чтобы нанести нистатин на все поверхности во рту вашего ребенка; между щеками и деснами, на языке, под языком, на нёбе и между губами и деснами. Затем аккуратно вылейте оставшийся нистатин в рот.

При нанесении крема с нистатином на соски смойте его перед кормлением, потому что он ужасен на вкус.

Миконазол (Дактрин®, Фунго®, Монистат®, Микатин®)

В Австралии и Европе противогрибковый крем и гели для перорального применения с миконазолом доступны для использования во рту ребенка и на сосках матери.Используйте ватный тампон, чтобы аккуратно нанести гель на все участки рта вашего ребенка.

Если НИСТАТИН или МИКРОНАЗОЛ изначально не эффективны или дрожжевые грибки становятся хроническими и инфицируют молочные протоки (что приводит к боли в молочных железах), доступны другие противогрибковые препараты. Вам нужно будет обратиться к врачу за советом и / или рецептом на них.

Клотримазол (Лотримин®, Мицелекс®, Канестен®)

Хотя клотримазол продается без рецепта, он является мощным противогрибковым средством.Кремы следует наносить на соски или ягодицы ребенка только в том случае, если нистатин или микроназол (упомянутые выше) не помогли, и только по рекомендации врача.

Флуконазол (Дифлюкан®)

Новое и широко назначаемое в настоящее время лекарство от вагинального дрожжевого грибка – флуконазол, принимаемый в виде пероральной таблетки, – используется для лечения дрожжевого грибка молочной железы у кормящих матерей. Это очень сильное противогрибковое средство, отпускаемое по рецепту. Хотя флуконазол можно использовать для лечения молочницы у младенцев, его обычно применяют в тяжелых или упорных случаях и редко используют в качестве первого варианта лечения молочницы у младенцев.

Кетоконазол (Низорал®, ДактаГОЛД®) или Итраконзазол (Споранокс®)

Ни один из этих широко используемых противогрибковых препаратов не рекомендуется для детей или кормящих женщин.

Генцианвиолет

Gentian Violet, традиционное средство от дрожжей и других инфекций, появилось задолго до появления большинства современных противогрибковых средств и антибиотиков. Эту форму лечения следует рассматривать только в том случае, если это рекомендовано врачом вашего ребенка. Несмотря на то, что он эффективен при лечении молочницы, существует риск ожога рта у ребенка при использовании этого лечения.

ПРЕДУПРЕЖДЕНИЕ. Несмотря на то, что Gentian Violet все еще доступен во многих странах, он был удален с рынка в Австралии и многих европейских странах, поскольку он содержит материал, который обоснованно подозревается в канцерогенности.

Когда молочница не проходит

Если молочница возвращается после завершения лечения, вероятно, дрожжевые грибки все еще присутствуют в доме. В этом случае может потребоваться лечение всех членов семьи, чтобы снизить риск повторного заражения вашего ребенка.Ваш врач будет лучшим человеком, чтобы дать вам совет, если это необходимо.

Дрожжевые грибки, вызывающие молочницу, могут длительное время выживать во влажной среде вне тела и могут таким образом передаваться от одного члена семьи к другому. Есть много вещей, которые вы можете сделать, чтобы снизить риск возникновения этого распространения.

Основные рекомендации были даны в каждом разделе для молочницы полости рта, молочницы, опрелостей и молочницы сосков/молочных желез выше, а дополнительные рекомендации приведены ниже.Поскольку многие из приведенных ниже рекомендаций требуют большой работы, нет необходимости заходить так далеко, если только вашего ребенка не беспокоят повторяющиеся эпизоды молочницы.

  • Правильное мытье рук – это самое важное, что вы можете сделать. Поощряйте взрослых и детей старшего возраста регулярно мыть руки теплой водой с мылом, особенно перед тем, как прикасаться к ребенку или играть с ним.
  • Мойте руки до и после смены подгузников, перед приготовлением смеси, а также до и после кормления ребенка.
  • Используйте бумажные полотенца для сушки рук, а затем выбросьте их, так как дрожжи могут жить на влажном полотенце.
  • Не купайте ребенка вместе с другими членами семьи.
  • Не делитесь банными полотенцами. Используйте полотенце только один раз или тщательно высушите после каждого использования.
  • Постельное белье, полотенца и нижнее белье могут нуждаться в обработке для уничтожения спор дрожжей и предотвращения повторного возникновения инфекции. Белье следует стирать в максимально горячей воде и сушить на солнце при максимальной температуре сушилки для белья.
  • Используйте противогрибковый стиральный порошок или добавьте 1 стакан уксуса при последнем полоскании.
  • Зубные щетки могут содержать дрожжи. Замените зубную щетку каждого члена семьи после начала противогрибкового лечения и снова после исчезновения всех симптомов.
  • Игрушки следует регулярно стирать в горячей мыльной воде и отбеливать. Не позволяйте другим детям пользоваться одними пустышками, сосками для кормления или игрушками, которые они берут в рот.
  • Дезинфицируйте поверхности, такие как коврик для пеленания, детская мебель и игрушки, 10% раствором отбеливателя.
  • Кипятите пустышки, зубные кольца, соски для бутылочек и детали молокоотсоса, которые соприкасаются с молоком или грудью, в течение 20 минут ежедневно, пока инфекция не исчезнет. (Споры термоустойчивы, стерилизации паром может быть недостаточно.) После того, как молочница исчезнет, ​​выбросьте пустышки и купите новые.
  • Ни в коем случае не кладите соску ребенка или соску для кормления в рот. (Вряд ли вы заразитесь молочницей от ребенка, потому что ваша иммунная система сильна, но вы можете передать дрожжевые грибки, находящиеся во рту, ребенку.А также бактерии, вызывающие кариес.)

Автор Ровена Беннетт.

© Copyright www.babycareadvice.com 2020. Все права защищены. Разрешение автора должно быть получено для копирования или воспроизведения любой части этой статьи.

границ | Устойчивость к клотримазолу у клинических изолятов Candida glabrata коррелирует с повышенной экспрессией препарата: H+ антипортеры CgAqr1, CgTpo1_1, CgTpo3 и CgQdr2

Введение

В последние годы Candida glabrata стал второй по частоте причиной инвазивного и слизистого кандидоза, уступив только C.albicans (Vermitsky, Edlind, 2004; Rodrigues et al., 2014; Yapar, 2014). C. glabrata действительно является причиной 15–20% всех известных инфекций Candida , при этом относительная заболеваемость увеличивается с каждым годом (Roetzer et al., 2011). Широкое использование противогрибковых препаратов как для лечения, так и для профилактики привело к огромному увеличению числа внутренне устойчивых инфекций, вызванных грибковыми возбудителями. Частота и относительно высокие уровни смертности от этих инфекций обычно объясняются способностью этих патогенных дрожжей эффективно развивать множественную лекарственную устойчивость (MDR; Vermitsky and Edlind, 2004; Sanguinetti et al., 2005; Резаи и др., 2009).

Азольные противогрибковые препараты, включая флуконазол (FLC) и клотримазол (CLT), широко используются в клинической практике (Pina-Vaz et al., 2001; Vermitsky and Edlind, 2004). Одним из наиболее частых препаратов азола, используемых для лечения грибковых инфекций слизистых оболочек, таких как кандидоз влагалища и ротоглотки, является имидазол клотримазол (Crowley and Gallagher, 2014). Флуконазол, с другой стороны, широко используется для профилактики и лечения кандидоза у реципиентов органов и костного мозга, пациентов, проходящих химиотерапию, и больных СПИДом.Было показано, что длительное воздействие флуконазола может способствовать возникновению инфекций C. glabrata (Abbes et al., 2013; Papon et al., 2013). Оба препарата действуют путем ингибирования ланостерол-14α-деметилазы, продукта гена ERG11 (Vermitsky and Edlind, 2004), ключевого фермента биосинтеза эргостерола. Однако тревожный процент клинических изолятов C. glabrata проявляет устойчивость к азолам, в отличие от того, что наблюдалось для большинства других видов Candida (Sanguinetti et al., 2005). Например, в исследовании с участием 33 изолятов C. glabrata было обнаружено, что 20 из них устойчивы к флуконазолу и кетоконазолу (Sanguinetti et al., 2005).

Существует в основном три описанных механизма устойчивости к азолам у Candida spp.: (i) повышенная продукция фермента-мишени азола Erg11, (ii) точечные мутации в том же ферменте, влияющие на связывание лекарственного средства, и (iii) опосредованный отток лекарственного средства. с помощью Cdr1 и Cdr2, мультилекарственных насосов оттока, принадлежащих к суперсемейству АТФ-связывающих кассет (ABC), или, в 90–198 C.albicans , с помощью Mdr1, главного переносчика надсемейства фасилитаторов (MFS) (Henry et al., 2000; Silva et al., 2011). Кроме того, было описано, что точечные мутации в ERG3 , кодирующем Δ 5,6 -десатуразу, нарушающие активность фермента, придают устойчивость к азолу (Martel et al., 2010). Однако недавний анализ механизмов, лежащих в основе приобретения лекарственной устойчивости к азолу у C. glabrata , позволяет предположить, что уровень экспрессии или аминокислотные замены гена ERG11 , по-видимому, не коррелируют с уровнями устойчивости к азолу у этого грибкового патогена. (Сангвинетти и др., 2005; Шведа и др., 2015).

У C. glabrata также было обнаружено, что устойчивость к азолам тесно связана с действием переносчиков мультилекарственных препаратов суперсемейства ABC CgCdr1 и CgCdr2 (Sanguinetti et al., 2005; Silva et al., 2011). Транспортеры MDR, принадлежащие MFS, недавно были связаны с этим феноменом (Costa et al., 2013a,b, 2014b). Было показано, что CgAqr1 придает устойчивость к флуцитозину и, в меньшей степени, к клотримазолу (Costa et al., 2013a), тогда как CgQdr2 придает устойчивость к имидазолам клотримазолу, тиоконазолу, миконазолу и кетоконазолу (Costa et al., 2013b), а CgTpo1_1, CgTpo1_2 и CgTpo3 придают устойчивость к имидазолам, а также к триазолам, итраконазолу и флуконазолу (Costa et al., 2014b; Pais et al., 2016). Что касается оставшихся пяти предполагаемых переносчиков лекарств из того же семейства в C. glabrata , то был охарактеризован только CgFlr1 (Costa et al., 2014a), но показано, что он не участвует в устойчивости к азолам (Chen et al., 2007). . Однако их клиническую значимость еще предстояло оценить, как, например, в 90–198 C.albicans , постоянно обнаруживается, что Mdr1 сверхэкспрессируется в устойчивых к флуконазолу изолятах (Wirsching et al., 2000a,b), но это не относится к переносчику C. albicans Flu1.

В этом исследовании оценивалась клиническая значимость пяти транспортеров ДГК, которые, как ранее было установлено, участвуют в устойчивости к азолам у C. glabrata (CgAqr1, CgQdr2, CgTpo1_1, CgTpo1_2 и CgTpo3). Коллекция клинических изолятов была охарактеризована в отношении чувствительности к двум препаратам, представителям семейств азольных противогрибковых препаратов: флуконазолу, триазолу, используемому для лечения и профилактики инвазивного кандидоза, и клотримазолу, имидазолу, используемому для лечения инфекций слизистых оболочек.В штаммов, отобранных для показа высокой или низкой клотримазол МИК экспрессию CgAQR1 , CgQDR2 , CgTPO1_1 , CgTPO1_2 и CgTPO3 анализировали, и по сравнению с CgCDR1 и CgCDR2 , использовали в качестве положительных контролей. Кроме того, один из анализируемых генов DHA, CgTPO3 , был удален в клиническом изоляте, устойчивом к азолу, демонстрирующем высокие уровни экспрессии CgTPO3 , и было проанализировано его влияние на чувствительность к азолу.

Материалы и методы

Candida glabrata Штаммы и питательные среды

Две коллекции клинических штаммов, включающие 75 изолятов, полученных от пациентов, поступивших в больницу Санта-Мария (HSM), Лиссабон, и 63 изолята, полученных от пациентов, посещающих Centro Hospitalar São João (CHSJ) (Costa-de-Oliveira et al., 2008). ; Faria-Ramos et al., 2014), Porto, использовались в этом исследовании (дополнительная таблица S1). Клетки культивировали в периодическом режиме при 30°С при орбитальном встряхивании (250 об/мин) в питательной среде YPD следующего состава (на литр): 20 г глюкозы (Merck), 20 г дрожжевого экстракта (Difco) и 10 г пептона (Difco). ).Для некоторых экспериментов использовали базальную среду (ВМ) следующего состава (на литр): 1,7 г дрожжевой азотной основы без аминокислот или NH 4 + (Difco), 20 г глюкозы (Merck) и 2,65 г (NH 4 ) 2 SO 4 (Мерк). Твердые среды содержали 20 г/л агара (Iberagar), помимо ингредиентов, перечисленных выше. Флуконазол (FLC) и клотримазол (CLT) были получены от Sigma, приготовлены в диметилсульфоксиде (Sigma), заморожены при -80°C до использования. Противогрибковые растворы, используемые для определения МИК, разводили средой RPMI 1640 (Sigma) и забуферивали до pH 7.0 с 0,165 М буфером морфолинпропансульфоновой кислоты (Sigma).

Тестирование чувствительности

изолятов C. glabrata

Минимальная ингибирующая концентрация (МИК) каждого противогрибкового препарата была определена в соответствии с протоколом M27-S4 Института клинических и лабораторных стандартов (CLSI) (CLSI, 2008, 2012) для изолятов, полученных из Centro Hospitalar São João, и согласно окончательному документу EUCAST EDef 7.2 (Rodríguez-Tudela et al., 2003) для изолятов, собранных в больнице Санта-Мария.Было показано, что методы EUCAST и CLSI дают аналогичные результаты в отношении определения МИК (Cuenca-Estrella et al., 2002; Rodriguez-Tudela et al., 2007; Pfaller et al., 2011). MIC определяли через 48 часов инкубации как для FLC, так и для CLT. Предельные значения чувствительности для FLC были предложены в документе CLSI M27-S4. Для СЛЦ пороговые значения МПК, позволяющие считать штамм чувствительным к дозе или устойчивым, составляли ≤32 мкг/мл или ≥64 мкг/мл (CLSI, 2008, 2012). В случае CLT нет установленных точек останова.Рассмотренные пороговые значения МИК – для чувствительности ≤0,5 мкг/мл и для резистентности ≥1 мкг/мл – соответствовали ранее опубликованным стандартам для C. albicans (Pelletier et al., 2000). Штамм типа C. glabrata CBS138 использовали для контроля качества тестирования чувствительности к противогрибковым препаратам.

Чувствительность клинического изолята 51800 и полученного мутанта 51800_Δ tpo3 к CLT и FLC сравнивали на основе определения МИК, как описано выше, и роста в твердой среде.Клетки C. glabrata выращивали в среде BM до середины экспоненциальной фазы (OD 600 нм = 0,4 ± 0,02) и разбавляли стерильной водой для получения суспензий с OD 600 нм = 0,05 ± 0,005. Эти клеточные суспензии и последующие разведения (1:5 и 1:25) наносили в виде пятен по 4 мкл на поверхность агаризованной среды ВМ, дополненной 20 и 24 мг/л CLT и 475 и 500 мг/л FLC.

Анализ экспрессии генов

Было отобрано 10 чувствительных к CLT и 10 устойчивых к CLT изолятов (таблица 3) для оценки уровней транскриптов генов MFS-MDR CgAQR1 , CgQDR2 , CgTPO1_1 , CgTPO1_2 и CgTPO1_2