Пробиотики с бифидобактериями: ТОП-11 пребиотиков для кишечника — рейтинг хороших средств 2020

Содержание

Пробиотики (живые микроорганизмы) для профилактики инфекций верхних дыхательных путей (ИВДП) (например, простуды)

Вопрос обзора

С связи с ростом потребления пробиотиков (живых микроорганизмов), мы провели обзор по профилактическим эффектам пробиотиков, помогающим людям (без иммунодефицита) предотвратить развитие острых инфекций верхних дыхательных путей (ИВДП), например, простуды, по сравнению с плацебо.

Актуальность

ИВДП включают в себя простуду и воспаление трахеи и гортани, с такими симптомами, как лихорадка, кашель, боль и головные боли. Большинство острых ИВДП вызваны вирусными инфекциями и обычно разрешаются через 3-7 дней. Для снижения заболеваемости этими инфекциями часто рекомендуют определенные вакцины, особенно детям и пожилым людям.

Некоторые пробиотики (живые микроорганизмы) могут принести пользу здоровью пациента при приеме в адекватных количествах. Молочнокислые бактерии и бифидобактерии являются наиболее распространенными видами пробиотиков. Их, как правило, потребляют в составе ферментированных пищевых продуктов, таких как йогурт и соевый йогурт, или в составе пищевых добавок. Однако, их эффекты в предотвращении ИВДП все еще плохо изучены.

Характеристика исследований и даты поиска

После поиска всех соответствующих клинических испытаний в научных базах данных, мы выявили 13 рандомизированных контролируемых испытаний (РКИ), опубликованных по июль 2014 года. Нам удалось извлечь и объединить данные из 12 РКИ с участием 3720 человек (обоих полов), в том числе детей, взрослых (в возрасте около 40 лет) и пожилых людей из Финляндии, Испании, Швеции, США, Хорватии, Чили, Таиланда и Японии.

Основные результаты

Было обнаружено, что пробиотики были лучше, чем плацебо по уменьшению числа участников, у которых развивались эпизоды острых ИВДП, примерно на 47%, и по уменьшению длительности эпизода острой ИВДП, приблизительно на 1,89 дней. Пробиотики могут немного уменьшить использование антибиотиков и число пропусков школы, связанных с простудой. Побочные эффекты пробиотиков были незначительными и наиболее распространенными из них были желудочно-кишечные симптомы.

Качество доказательств

Качество доказательств было низким или очень низким, в основном из-за плохого проведения клинических испытаний, например, с неясным методом рандомизации и ослепления. Некоторые клинические испытания были поддержаны производителями исследуемых пробиотиков и в некоторых клинических испытаниях был очень небольшой размер выборки.

Выводы

В целом, мы обнаружили, что пробиотики лучше, чем плацебо, в предотвращении острых ИВДП. Однако, необходимо больше клинических испытаний для подтверждения этого вывода.

Штамм BB-12® – наиболее изученные бифидобактерии в мире

Бифидобактерии были обнаружены и выделены из стула грудных детей в 1899 году.1 Бифидобактерии BB-12® компании Chr. Hansen (далее именуемые BB-12®) производятся из нашей коллекции молочных культур и используются в детских смесях, пищевых добавках и кисломолочных продуктах (например, йогуртах) во всем мире с 1986 года. 

Лабораторные исследования показали, что штамм BB-12® отлично сохраняется как в растворе желудочной кислоты при pH 2,5, так и в 1% растворе свиной желчи. Данные характеристики позволяют пробиотическому штамму сохраниться при прохождении через желудочно-кишечный тракт. (Справочная информация: Данные Департамента по развитию подразделения Human Health компании Chr. Hansen).  

 

Штамм

Bifidobacterium animalis subsp. lactis, BB-12® является наиболее изученной бифидобактерией в мире 

Штамм BB-12® описан примерно в 400 научных публикациях и подтвержден более чем в 200 публикациях, описывающих клинические исследования. По результатам научных исследований было установлено, что BB-12® оказывает позитивное влияние на здоровье желудочно-кишечного тракта и иммунитет. Штамм BB-12

® был испытан на большом количестве людей различных возрастных групп, включая недоношенных детей и лиц преклонного возраста, при этом тестирование проводилось для разных направлений сферы здравоохранения. 

 

Штамм

Bifidobacterium, BB-12® имеет ряд полезных факторов для здоровья  

У младенцев и детей:

  • Здоровье пищеварительной системы†  
    Обеспечивает более мягкое и частое опорожнение кишечника,2 а также более короткие и редкие эпизоды жидкого стула3, 4 и в целом более регулярному стулу.19
  • Частый плач и беспокойство*  
    Ассоциируется со значительно меньшей частотой плача и беспокойства у младенцев.
    5, 19
  • Дневной сон* 
    Имеет отношение к увеличению продолжительности дневного сна у чрезмерно плаксивых и беспокойных детей, а также к улучшению самочувствия и связанного с ним качества жизни родителей и персонала, осуществляющего уход за детьми.19
  • Здоровье органов дыхания†  
    Меньшее количество эпизодов респираторного дискомфорта.6, 7, 8
    
  • Здоровье иммунной системы†  
    Ассоциируется с лучшей поддержкой иммунной системы.9
  • Здоровье кожи*  
    Ассоциируется с меньшей частотой случаев красных, сухих и шелушащихся участков кожи у младенцев.
    10
     

Взрослые:  

  • Здоровье полости рта*  
    Ассоциируется с более низким содержанием в слюне определенных бактерий, которые вызываютт ухудшение здоровья полости рта.11
  • Частота опорожнения кишечника†  
    Более регулярная работа кишечника у людей взрослого12, 13 и пожилого возраста.14
  • Здоровье иммунной системы*  
    Улучшение функционирования иммунной системы.15
  • Уровни холестерина# 
    Поддерживает здоровый уровень холестерина.16

 

* исследованы отдельно
# исследованы в комбинации с другими штаммами
† исследованы отдельно и в комбинации с другими штаммами


Пробиотический штамм BB-12® компании Chr. Hansen обладает превосходным качеством  

В компании Chr. Hansen налажен уникальный производственный процесс с полным контролем всех этапов производства наших пробиотических штаммов. В результате мы можем предложить высококачественные пробиотические штаммы, абсолютно безопасные для применения.  

  • Штамм BB-12® компании Chr. обладает 100% стабильностью генома в течение десятилетий 
  • Штамм BB-12® компании Chr. Hansen остается стабильным в течение трех лет при температуре 30 градусов (зона 4b)
  • Штамм BB-12® компании Chr. Hansen, находящийся в составе продуктов, демонстрирует превосходную стабильность при использовании, термоустойчивость при введении и стабильность при хранении.
  • Штамм BB-12® компании Chr. Hansen получил статуса GRAS (Общепризнан как безопасный) Управления по санитарному надзору за качеством пищевых продуктов и медикаментов США (FDA) как для младенцев, так и для остальных возрастных групп населения.17 

В 2007 году Европейское агентство по безопасности продуктов питания (EFSA) присвоило Bifidobacterium animalis статус QPS Квалифицированная презумпция безопасности) – статус, предоставляемый на уровне видов.

18  

 

BB-12® является зарегистрированной торговой маркой компании Chr. Hansen A/S.
  

Справочная информация  
1 Jungersen, et al. BB-12®. Microorganisms. 2014;2:92-110.
2 Vlieger AM, et al. Br J Nutr. 2009;102(6):869-75.
3 Weizman Z, et al. Pediatrics. 2005;115(1):5-9.
4 Saavedra JM, et al. Lancet. 1994;344(8929):1046-9.
5 Nocerino R, et al. Aliment Pharmacol Ther. 2020;51(1):110-20.
6 Taipale TJ, et al. Br J Nutr. 2011;105(3):409-16.
7 Taipale TJ, et al. Pediatr Res. 2016;79(1-1):65-9.

8 Rautava S, et al. Br J Nutr. 2009;101(11):1722-6.
9 Holscher HD, et al. J Parenter Enteral Nutr. 2012;36 (1 Suppl):106s-17s.
10 Isolauri E, et al. Clin Exp Allergy. 2000;30(11):1604-10.
11 Caglar E, et al. Acta Odontol Scand. 2008;66(3):154-8.
12 Eskesen D, et al. Br J Nutr. 2015;114(10):1638-46.
13 Uchida K, et al. Journal of Nutritional Food. 2005;8:39-51.
14 Pitkala KH, et al. J Nutr Health Aging. 2007;11(4):305-11.
15 Rizzardini G, et al. Br J Nutr. 2012;107(6):876-84.
16 Ejtahed HS, et al. J Dairy Sci. 011;94(7):3288-94.
17 Управление по санитарному надзору за качеством пищевых продуктов и медикаментов США. Уведомление GRAS > Ответное письмо агентства, уведомление GRAS № GRN 000049. 2002.
18 Группа экспертов EFSA по биологическим опасностям (BIOHAZ). Заявление об обновлении списка биологических агентов, рекомендованных QPS, намеренно добавленных в пищу или корм в соответствии с уведомлением EFSA 3: Пригодность таксономических единиц, уведомление EFSA до сентября 2015 года. EFSA Journal. 2015;13:4331. 
19 Chen et al. Beneficial microbes, 2021.

 

 

 

Данная информация предназначена только для профессионалов коммерческой сферы и сотрудников здравоохранения. Данная информация не предназначена для конечных потребителей. Информацию, представленную на данной странице, не следует воспринимать в качестве неоспоримого утверждения.  

как связаны роды, иммунитет и кишечный микробиом

В 2015-м журнал Nature назвал человеческий микробиом героем года. Больше всего микроорганизмов живет в нашем кишечнике: ученые считают, что это самая богатая экосистема на Земле. О том, когда возникает микробиом кишечника, как процесс родов влияет на его формирование и почему молоко конкретной женщины предназначено только для ее ребенка, рассказывает педиатр и неонатолог Ян Мазеля в интервью из книги Маргит Коссобудзки «Человек на бактериях».

Маргит Коссобудзка
Попурри. 2019

— Начало жизни — это также начало взаимодействия с бактериями, которые заселяют наш кишечник всю жизнь. Этот старт имеет ключевое значение, но, собственно говоря, почему?

— Должен иметь, если, согласно научным данным, средний организм человека в возрасте 20–30 лет весом 70 кг и ростом 170 см состоит из приблизительно 30 миллиардов клеток, а также… 39 миллиардов бактерий, масса которых 2-3 кг.

Кишечные микроорганизмы играют существенную роль в здоровье человека. Это одни из первых антигенов (то есть чужеродных белков), с которыми связана иммунная система. Следовательно, они имеют ключевое значение для развития нашего иммунитета.

На самом деле рождение — это вовсе не начало нашей связи с бактериями. Они пребывают с нами уже на стадии плода.

Будущее нашего кишечного микробиома предопределяет состояние матери во время беременности. В частности, доказано, что факторами, влияющими на микробиоту ребенка, являются: прием женщиной антибиотиков во время беременности, ее масса тела, уровень стресса, бактериологическое состояние ротовой полости и гестационный диабет. Интересно, что молоко матерей с лишним весом или матерей, которые во время беременности набрали больше килограммов, чем рекомендуется, характеризуется меньшим разнообразием бактерий.

А как показывают исследования, нарушенная бактериальная флора кишечника младенца повышает риск бронхиальной астмы, заболеваний дыхательных путей, ожирения или астмы в будущем.

Хотите жить в согласии со своим организмом и не чувствовать себя совой в мире жаворонков? Рассказываем, как это сделать, на практическом курсе по биохакингу.

— Почему так происходит?

— Потому что иммунная система новорожденного неразвита, при этом мы имеем дело с доминированием лимфоцитов Th3, в связи с чем при отсутствии физиологического механизма представления телу очередных антигенов так, чтобы оно научилось их распознавать, мы нарушаем ее дальнейшее формирование.

Хотелось бы здесь также вспомнить о гипотезе гигиены. За последние 50 лет резко изменилась частота возникновения инфекционных заболеваний. Мы проводим скрининговые тесты, вакцинации,

у нас теперь нет смертей из-за туберкулеза, свинки, краснухи, гепатита А, но зато растет частота возникновения цивилизационных болезней.

А все потому, что мы изменили на первых днях, неделях жизни этот аспект презентации антигенов.

— Трудно поверить, что первые месяцы жизни так важны. Перед нами множество выборов, как сформировать эту жизнь. А вы говорите, что в некотором смысле наше здоровье формируется в самом начале.

— Именно так оно и есть, это наша физиология. Более того, сейчас все чаще подчеркивают значение первой тысячи дней в программировании здоровья человека. От зачатия до примерно второй-третьей недели жизни ребенка мы можем буквально «модулировать» здоровье человека в долгосрочной перспективе. На это влияют питание и состояние микробиоты как матери, так и младенца.

Известно, что детям, у которых на первых месяцах жизни выявлено меньше бактерий родов Lactobacillus и Bifidobacterium, в пятилетнем возрасте ставят диагноз аллергия.

В 2015 году доктором Мари-Клэр Арриетой из Университета Британской Колумбии в Ванкувере было проведено уникальное исследование, заслуживающее внимания. Ее команда отметила, что в первые три месяца жизни ребенка снижение количества четырех родов бактерий Faecalibacterium, Lachnospira, Veillonella и Rothia повышает риск проявления симптомов астмы до трехлетнего возраста. Но если тот же дефицит бактерий встречается у годовалых детей, то это не имеет уже никакого значения — риск возникновения аллергии в старшем возрасте не увеличивается. Следовательно, мы имеем дело с уже упомянутым модульным окном. Ненормальная микрофлора кишечника стимулирует иммунную систему так, что изменение колонизации на раннем этапе грозит последствиями в будущем.

Ключевыми являются также естественные роды. Доказано, что вагинальные роды способствуют заселению кишечника ребенка бактериями Lactobacillius, Prevotella, Senthia spp. В свою очередь, роды через кесарево сечение благоприятствуют колонизации кожными бактериями Staphylococcus, Corynebacterium или Propionibacterium spp.

Важно отметить, что микробиом детей, родившихся через незапланированное кесарево сечение, «лучше», чем у тех, которые появились на свет через запланированное, то есть элективное.

Исследования с участием канадских детей показывают, что микрофлора кишечника новорожденных, которые появились на свет через незапланированное кесарево сечение, то есть уже после начатого процесса родов, характеризуется бо́льшим разнообразием и богатством бактерий, а также в большей степени напоминает микробиом детей, рожденных вагинальным путем, в отличие от тех, которые родились с помощью заранее запланированной операции! Данное исследование несколько ограниченно. В нем не учитываются продолжительность и течение родов, антибиотикотерапия, естественный разрыв или прокол плодного пузыря, а также прочие вмешательства, которые могут воздействовать на микробиом. Но, несмотря на это, оно весьма показательно.

Хотите жить в согласии со своим организмом и не чувствовать себя совой в мире жаворонков? Рассказываем, как это сделать, на практическом курсе по биохакингу.

— Вы утверждаете, что состав кишечной микробиоты у детей со временем изменяется. Как именно?

— Сначала в кишечнике новорожденного появляются бактерии, относящиеся к разряду факультативных анаэробов, то есть таких, которые переносят кислород в определенном количестве. Далее наступает черед облигатных анаэробов, в основном Bifidobacterium. Интересно, что эти факультативные анаэробы нам крайне необходимы в самом начале, поскольку они подготавливают среду кишечника для полезных бактерий рода Bifidobacterium, которые особенно важны в период новорожденности, а также в будущем для прочих анаэробных организмов.

Источник: Luis M Molina / istockphoto.com

Постепенно также растет разнообразие кишечной микробиоты приблизительно до момента введения твердой пищи в рацион ребенка, позднее — примерно в возрасте двух лет — эта кривая достигает пика; микробиота уже так значительно не меняется, а становится похожа на микробиоту взрослого человека.

Во время презентации я показываю так называемые профили микробиоты 30 детей грудного возраста. Стрелками там отмечены места, где невооруженным глазом видно, что наступило большое изменение в профиле бактерий. Такой скачок происходит между 118-м и 370-м днями жизни. Как вы думаете, что послужило тому причиной?

— Отлучение от груди?

— Нет, для этого еще рано, и дело не в этом. В данный период мы вводим дополнительное питание! А что происходит на 80-м дне жизни ребенка? Здесь тоже скачок. Почему?

— Это третий месяц. Не знаю. Родители завели собаку?

— Собака — это хорошо, поскольку она увеличивает микробиотическое многообразие в кишечнике ребенка. То же самое, если есть братья и/или сестры. Но и здесь дело не в этом, а в том, что ребенок просто начинает класть ручки в рот. А что на этих ручках? Все.

— Собака — это хорошо, а что еще?

— Форма кормления ребенка в постнатальный период. Лучше всего, конечно, кормить грудью, поскольку тогда заселение кишечника малыша Bifidobacterium и Lactobacillus достигает 90 процентов. Если молоко модифицировано, то, к сожалению, в таком случае у детей больше бактерий родов Bacteroides, Staphylococcus, Escherichia и Clostridium.

Кроме того, человеческое молоко обладает богатым микробиомом, который содержит 700 видов живых бактерий. Так, например, в молозиве обнаружены: Weissella, Leuconostoc, Staphylococcus, Streptococcus и Lactococcus. Позже, в период с первого по шестой месяц вскармливания, типичными бактериями в молоке являются: Veillonella, Prevotella и Leptotrichia.

Грудное молоко не только питает организм ребенка, это также синбиотик. Причем очень индивидуальный. Синбиотиком называется комбинация пробиотика (бактерий) и пребиотика (пищи для бактерий), оказывающая синергическое действие, при котором нормализуется микрофлора кишечника. Данный термин прежде всего относится к продуктам, в которых пребиотический компонент выборочно способствует развитию пробиотического компонента, например, пребиотик олигофруктоза побуждает размножение бактерий Bifidobacterium в желудочно-кишечном тракте (ЖКТ).

Молоко также изменяется со временем.

В стационаре я всегда повторяю мамам, у которых случились преждевременные роды: «Дорогая мама, сделайте все, чтобы вскармливать ребенка естественным путем. Если вы хотите, чтобы мы спасли этого 500-граммового малыша, то потребуется ваше молоко — нет лекарства лучше».

И дело не только в питательной ценности, но и в ценности пребиотической и пробиотической.

В 2016 году в журнале The Lancet был опубликован обширный метаанализ исследований, который показал, что грудное кормление снижает риск инфекций нижних дыхательных путей в течение первых двух лет жизни, а также возникновения жидкого стула и воспаления ЖКТ. Вопрос — почему? Знаете ли вы, какой элемент молока за это отвечает?

Хотите жить в согласии со своим организмом и не чувствовать себя совой в мире жаворонков? Рассказываем, как это сделать, на практическом курсе по биохакингу.

— Знаю, об этом много говорят. Это олигосахариды.

— Именно так. Олигосахариды, которые практически отсутствуют в коровьем молоке. Их содержание на 1 литр молока матери достигает 10–15 г, а в молозиве — целых 30 г на 1 литр! Исследования, проведенные в 2017 году, показали, что на позднейших неделях вскармливания количество олигосахаридов в молоке уменьшается. Они должны иметь какое-то значение. Но какое, раз они не обладают никакой питательной ценностью?

В молоке матери содержатся свободные олигосахариды, гликопротеины — в том числе секреторные IgA (sIgA), такие как лактоферрин, гликолипиды и гликозаминогликаны. Все эти вещества не обладают особой питательной ценностью. Только в последние годы мы начали понимать, как они работают, а история этих веществ длинная и очень занимательная.

В XIX веке смертность новорожденных в Европе составляла 30%, то есть каждый третий ребенок умирал в течение первого года жизни. Причиной тому были инфекции, однако не те, которые связаны с неправильной гигиеной. Дети умирали в основном потому, что из-за проблем с лактацией каждого третьего не вскармливали грудью.

Были кормилицы, но их могли позволить себе только богатые люди. Среднестатистическим европейцам приходилось прибегать к использованию смеси воды, муки и коровьего молока, вследствие чего у детей понижался иммунитет, поскольку в этих веществах не было упомянутых олигосахаридов.

Производители заменителей молока осознали, какую важную роль играет их продукт, поэтому сегодня в большинстве таких препаратов содержатся фруктоолигосахариды (ФОС) или галактоолигосахариды (ГОС). Это тоже олигосахариды, только растительного происхождения. Если их применять в правильном соотношении, то есть ГОС/ФОС 9:1, то они дадут определенный противовоспалительный и пребиотический эффект. Согласно обширным клиническим исследованиям, комбинация олигосахаридов ГОС/ФОС снижает риск инфекций верхних дыхательных путей.

Источник: Luis M Molina / istockphoto.com

— Как именно действуют олигосахариды?

— Они способны блокировать так называемые лектиновые рецепторы, которые присутствуют на патогенных бактериях, из-за чего те не могут присоединиться к эпителию кишечника, а также способствуют колонизации полезных симбиотических бактерий. Кроме того, их благоприятное воздействие заключается в том, что они почти негидролизированы и представляют собой питательную среду для кишечных бактерий. И наконец, третий механизм — это иммуномодуляция. Часть этих олигосахаридов (около 10%) может подвергнуться гидролизу и пройти через стенку кишечника, стимулируя при этом выработку противовоспалительных цитокинов.

Доказано, что благодаря так называемым фуколизированным олигосахаридам увеличивается рост количества Bifidobacterium и одновременно приостанавливается рост таких микробов, как Streptococcus, Escherichia и Enertobacterie. На стерильных, так называемых гнотобиотических мышах доказано, что при введении в рацион этих олигосахаридов у животных отмечается высокое содержание Bifidobacterium, а при прекращении их количество резко уменьшается.

— Насколько ценно для ребенка молоко от другой матери?

— Материнское молоко — индивидуальный синбиотик. Сося грудь, каждый ребенок колонизирует молочную железу матери своими бактериями из ротовой полости. Однако молоко от другой матери несомненно лучше для человеческого детеныша, чем коровье.

Но здесь мы сталкиваемся с проблемой, с которой боремся в «молочных банках».

Что сделать для того, чтобы в донорском молоке тоже была какая-нибудь микробиота? Ведь после пастеризации этих бактерий в нем уже нет. В связи с этим возникла идея фаунификации, то есть инокуляции, донорского молока или искусственного питания бактериями, извлеченными из груди кормящих женщин.

Над этим работают уже несколько групп ученых в мире.

Известно, что физиологические изменения во время беременности и после родов облегчают проникновение бактерий в молочные железы. Гормональные изменения, происходящие в этот период, могут оказывать влияние на кишечную проницаемость, что, в свою очередь, способствует захвату бактерий из кишечника матери и переходу их в ее молоко. Обширные многоцентровые исследования показали, что бактерии Lactobacillus fermentum, добавляемые в молочный препарат, наполовину снижают частоту возникновения кишечных инфекций и на 30% — инфекций верхних дыхательных путей!

— Иногда нет выхода, и приходится кормить ребенка смесью или же рожать через кесарево сечение. Можно ли как-то спасти положение?

— Все больше и больше говорят о микробиотических терапиях, которые «воспроизводят» нарушенную микробиоту кишечника. Одна из них — смазывание новорожденного выделениями из влагалища матери (vaginal seeding). Данная терапия заключается в том, что сразу после родов рот, лицо и все тело ребенка протирают марлей, пропитанной влагалищными выделениями.

К нам приходит много беременных женщин с просьбой выполнить такую процедуру при рождении ребенка. Однако проблема в том, что официально ее не утвердили в качестве медицинской процедуры. Мы ведем научные исследования, но нам пришлось полгода воевать с биоэтическим комитетом, чтобы получить на это согласие. Дело в том, что мы никогда не можем с уверенностью сказать, что именно находится в микробиоте матери. Несколько центров в Европе тоже проводят похожие исследования, но их основная цель — доказать, что такая процедура безопасна, поскольку если бы мы «наградили» ребенка таким способом ВИЧ, хламидийной, микоплазменной пневмонией или стрептококками группы B, то у нас были бы большие проблемы.

В рамках исследований при кесаревом сечении мы переносим микробиоту влагалища на ребенка, но, как оказалось, необходимо также переносить мазок из ануса, поскольку кишечная палочка, вероятно, играет еще более важную роль, чем сам влагалищный микробиом! Но в таком случае биоэтический комитет точно не выразит согласия на исследования.

— Откуда взялась идея с мазком из ануса?

— Во время физиологических родов ребенок сталкивается не только с репродуктивным трактом матери, но также с микробиомом ее ануса. Все это соединено между собой и, согласно исследованиям, имеет значение, что вполне очевидно, так как эволюция редко делает что-то бессмысленно.

Естественные роды и вскармливание грудью — самая лучшая профилактика инфекционных заболеваний в детском возрасте.

— Можно ли давать ребенку пробиотики? Насколько это эффективно?

— Проведено много исследований, доказывающих эффективность пробиотиков уже в период беременности. Чаще всего их давали во 2-й и 3-й триместры; пробиотики вызывали уменьшение случаев возникновения атопического дерматита у детей до четырехлетнего возраста, а также благодаря им реже отмечалось раздражение дыхательных путей.

Однако до сих пор не хватает однозначных показаний к применению пробиотиков среди недоношенных детей. Мы их применяем, но не стандартно, а в отдельных случаях, когда сочтем это необходимостью. Все потому, что были ситуации, когда пробиотики стали причиной гибели таких малышей. Это было связано с переносом пробиотических штаммов через барьер кишечник–кровь, что вызывало общее воспаление. Впрочем, такой механизм функционирует в этиопатогенезе некротического энтероколита (НЭК).

— Изменится ли это когда-нибудь? Сможем ли мы каким-либо образом искусственно воспроизводить здоровую микробиоту кишечника?

— Не исключено, что в будущем станет возможной индивидуальная целевая модуляция кишечной микробиоты. Ведутся также дальнейшие исследования взаимодействия кишечных бактерий с иммунной системой; возможно, придет время, когда трансплантация материнской микробиоты во время родов через кесарево сечение станет стандартной формой терапии.

Заменит ли это естественную, здоровую микробиоту кишечника — трудно сказать. Нам еще многое о ней неизвестно, а факторов, которые оказывают на нее воздействие, немало. К ним относятся стресс, никотин, лишний вес, антибиотикотерапия, вид родов, питание, продолжительность беременности и госпитализация.

В рубрике «Открытое чтение» мы публикуем отрывки из книг в том виде, в котором их предоставляют издатели. Незначительные сокращения обозначены многоточием в квадратных скобках. Мнение автора может не совпадать с мнением редакции.

Где можно учиться по теме #биохакинг

Читайте нас в Facebook, VK, Twitter, Instagram, Telegram (@tandp_ru) и Яндекс.Дзен.

Лучшие сорбированные пробиотики для восстановления микрофлоры кишечника

Автор: 12333 Дата: 16.04.2020 Просмотров: 659 Комментарии: 0

Пробиотики для кишечника – необходимость, особенно, если вы прошли курс антибиотиков, который буквально убивают микрофлору. К препаратам пробиотикам относятся те, что содержат штаммы живых бактерий, необходимых для нормальной работы кишечного тракта. Сравнение пробиотиков показывает, что некоторые из них эффективны, а некоторые – не всегда справляются с поставленной задачей. Поэтому, необходимо подобрать такие современные пробиотики, которые помогут наладить работу ЖКТ.

Пробиотики для кишечника: польза

Пробиотики нового поколения – это вещества, способные стимулировать естественную микрофлору кишечника, а также населять ее дополнительным количеством полезных микроорганизмов. Бывают следующе виды пробиотиков – с одним видом микроорганизмов или с несколькими.

Все сильные пробиотики дают следующие результаты:

·         Укрепление иммунитета.

·         Линекс пробиотик, как и ему подобные, восстанавливает микрофлору после приема антибиотиков.

·         Пробиотики препараты в Беларуси выводят из организма аллергены и токсины.

·         Живые пробиотики нормализуют уровень кислотности в толстом кишечнике.

·         Сорбированные пробиотики улучшают усвоение микроэлементов и витаминов.

Однокомпонентные пробиотики (список препаратов можно найти в интернете) содержат в своем составе только один вид бактерий. Это могут быть пробиотики с бифидобактериями или пробиотики с лактобактериями. Если говорить о многокомпонентных препаратах, то они могут включать от двух до тридцати штаммов. Более сложный состав делает лучшие пробиотики для восстановления микрофлоры кишечника наиболее эффективными. Кроме этого, наш интернет-магазин предлагает доктор мом сироп от кашля.

Пробиотики для кишечника: названия препаратов и особенности

Недорогие пробиотики помогают не только после того, как вы приняли антибиотики. Проблема может возникнуть и по другим причинам – на здоровье кишечника влияют многие факторы. Вы можете выбрать пробиотики в таблетках или пробиотики в капсулах.

Рейтинг пробиотиков, вызывающих доверие у покупателей:

·         Хилак Форте – самый лучший пробиотик, о котором знают все. Натуральное средство на растительных компонентах. Можно покупать без рецепта.

·         Бифидум – дешевые пробиотики, который является лучшим для того, чтобы ликвидировать последствия приема антибиотиков.

·         Энтерол 250 – оказывает комплексное воздействие за счет продуманной формулы. Отлично зарекомендовал себя при дисбактериозе.

Какой пробиотик самый эффективный? На это вопрос может ответить только врач, определив, какой препарат лучше всего подойдет именно вам. 

Пробиотики (Bifidobacterium longum) увеличивают плотность костной массы и усиливают регуляцию генов Sparc и Bmp-2 у крыс с потерей костной массы в результате овариэктомии

Пробиотики — это живые микроорганизмы, оказывающие благотворное воздействие на хозяина при введении в адекватных количествах. В основном пробиотики влияют на желудочно-кишечный тракт (ЖКТ) хозяина и изменяют состав кишечной микробиоты. В настоящее время частота переломов шейки бедра вследствие остеопороза увеличивается во всем мире. Овариэктомированные (OVX) крысы имеют хрупкие кости из-за дефицита эстрогена и имитируют менопаузальные состояния у женщин.Таким образом, это исследование было направлено на изучение влияния Bifidobacterium longum ( B. longum ) на плотность костной массы (BMD), содержание минералов в костях (BMC), ремоделирование кости, структуру кости и экспрессию генов у крыс OVX. Крыс случайным образом разделили на 3 группы (имитация, OVX и группа OVX с добавлением 1 мл B. longum 10 8 –10 9 колониеобразующих единиц (КОЕ)/мл). B. longum вводили один раз в день в течение 16 недель, начиная с 2-й недели после операции.Добавка B. longum увеличивала () сывороточный остеокальцин (OC) и остеобласты, параметры костеобразования и уменьшала сывороточный С-концевой телопептид (CTX) и остеокласты, параметры резорбции кости. Это также изменило микроструктуру бедренной кости. Следовательно, он увеличивал МПК за счет увеличения экспрессии генов Sparc и Bmp-2 . B. longum облегчал потерю костной массы у крыс OVX и повышал МПК за счет снижения резорбции кости и увеличения костеобразования.

1. Введение

Остеопороз представляет собой нарушение обмена веществ в костях, которое объясняется низкой костной массой и ухудшением состояния костной ткани, что приводит к увеличению слабости костей. Вследствие остеопороза снижается плотность костной ткани и микроархитектоника костной ткани, что приводит к риску переломов [1]. Частота переломов шейки бедра вследствие остеопороза увеличивается во всем мире, и риск переломов больше всего подвержен пожилому населению [2]. Общее количество лет жизни с поправкой на инвалидность составило 5 лет.8 миллионов по всему миру. Пятьдесят один процент от этого числа был результатом переломов, которые произошли в основном у жителей Европы и Америки. Таким образом, остеопоротические переломы были зарегистрированы как важная причина смертности и заболеваемости, особенно в развитых странах [3]. Действительно, наиболее распространенный тип остеопороза связан с постменопаузальными состояниями у женщин в возрасте 50 лет и старше [4].

Треть продолжительности жизни женщин приходится на период менопаузы [5]. Таким образом, необходимо уменьшить неблагоприятное влияние менопаузы на здоровье женщины.Было показано, что заместительная гормональная терапия (ЗГТ) снижает риск переломов у пациентов с остеопорозом. Однако из-за его ежедневного введения большинству женщин это лечение не нравится. Более того, ЗГТ увеличивает вероятность онкогенеза [6]. Поэтому определение альтернативных способов увеличения костеобразования и поддержания прочности костей считается жизненно важным, особенно для женщин в менопаузе.

Возможным методом лечения остеопороза является употребление пробиотиков [7, 8].Пробиотики — это живые микроорганизмы [9], иногда получаемые из ферментированных пищевых продуктов [10], которые оказывают благотворное физиологическое воздействие на хозяина при введении в адекватных количествах [9, 11]. Недавно в нескольких исследованиях сообщалось, что пробиотики могут снижать заболеваемость остеопорозом [8, 12, 13]. Некоторые штаммы пробиотиков исследуются на предмет их влияния на остеопороз, такие как Lactobacillus casei , Lactobacillus plantarum , Lactobacillus paracasei, и Bifidobacterium longum ( B.лонгум ).

Недавно была изучена важная функция кишечной микробиоты (КМ) в лечении различных заболеваний, включая потерю костной массы. GM состоит из миллионов бактерий и может модулироваться некоторыми факторами окружающей среды, такими как диета. Отсутствие GM у стерильных мышей увеличивало потерю костной массы. Однако колонизация безмикробных мышей с нормальным GM повышала иммунитет и костную массу [14]. Пробиотики в основном действуют, изменяя состав GM [15] и повышая растворимость и абсорбцию минералов, что приводит к модуляции иммунной системы [16, 17].Процесс ремоделирования кости представляет собой одну систему, модулируемую пробиотиками [12].

Регуляция костного метаболизма сложна, и некоторые факторы, такие как генетика, окружающая среда и образ жизни, способствуют костному метаболизму [18]. Кроме того, генетические факторы играют жизненно важную роль в обмене костной ткани, на долю которых приходится от 70 до 80% вариаций плотности костей [19]. Клетки, влияющие на плотность костей, — это остеобласты, остеокласты, остеоциты и клетки выстилки со своей собственной структурой и ролью.На эти клетки главным образом воздействуют пробиотики в процессе ремоделирования кости [1]. Остеокласты представляют собой крупные многоядерные клетки, связанные с остеокластогенезом и отвечающие за резорбцию кости. Остеобласты являются мононуклеарными клетками костеобразования и отвечают за формирование и минерализацию костей. Остеоид располагается на поверхности кости и играет роль в механической стимуляции и инициации реакции ремоделирования [20].

Овариэктомия у крыс вызывает потерю костной массы [21].OVX определяется как хирургическое удаление одного или обоих яичников. Этот термин обычно используется в фундаментальных научных исследованиях для объяснения удаления яичников у лабораторных животных, включая грызунов. OVX приводит к потере способности секретировать эстроген и прогестерон. Кроме того, операция также снижает выработку тестостерона и приводит к состоянию, известному как хирургическая менопауза. Таким образом, при хирургическом процессе OVX снижается уровень половых гормонов, что сопровождается увеличением потери костной массы и риском переломов костей, которые аналогичны менопаузальным остеопоротическим состояниям у женщин.

Насколько нам известно, исследования воздействия B. longum на крыс OVX не проводились и не публиковались. Таким образом, целью данного исследования было изучение эффективности пробиотика B. longum в защите крыс от потери костной массы, вызванной OVX. Кроме того, в этом исследовании оценивалась экспрессия набора ключевых генов, связанных с костным метаболизмом.

2. Материалы и методы
2.1. Модель животных и потребление пищи

Двадцать четыре 10-недельных половозрелых самки Sprague Dawley крысы со средним весом 280–290   г были получены с факультета медицины и медицинских наук Университета Путра Малайзии. (Серданг, Селангор, Малайзия).Крыс помещали в пластиковые клетки в помещении для животных с контролируемой средой при °C с 12-часовым циклом свет/темнота. Их акклиматизировали в течение двух недель и давали стандартный корм для крыс (Ridley Agri Products, Сидней, Новый Южный Уэльс, Австралия) (таблица 1) и доступ к воде вволю. Исследование на животных проводилось в помещении для животных на факультете медицины и здравоохранения Университета Путра Малайзии. Правила использования животных строго соблюдались. Исследование было одобрено Комитетом по уходу и использованию животных (ACUC) факультета медицины и здравоохранения Университета Путра Малайзия с номером разрешения UPM/FPSK/PADS/BR-UUH/00483.


Стандартный крысиный Chow диета ингредиент

Сырой протеин 21,0%
Сырая клетчатка 7,3%
Сырой жир 3,0%
влаги 13,0%
Зола 8,0%
кальция 1,0%
Фосфор 0.5%
Безазотистый экстракт 49,0%

2,2 Хирургическая процедура и группировка

Крыс взвешивали с помощью цифровых весов (Marte-AS 2000C, Сан-Паулу, Бразилия), и перед операцией крысы с одинаковой массой тела были случайным образом разделены на 3 группы по 8 крыс в каждой. группа, а именно, G1: ложная овариэктомия (фиктивная), G2: овариэктомия (OVX) и G3: OVX + Bifidobacterium longum (OVX + B.лонгум ). Затем в определенных группах была проведена либо фиктивная операция OVX, либо операция OVX. Массу тела определяли один раз в неделю. Перед операцией крыс анестезировали комбинацией ксилазина и кетамина 12 мг/80 мг/кг, вводимой внутрибрюшинно [22]. Все операции делал один и тот же хирург.

2.3. Пробиотическая добавка

После операции крыс снова поместили в клетку на 2 недели для восстановления. Затем крысам в группе 3 вводили 1 мл B.longum (10 8 –10 9 ) (КОЕ/мл) вводили через зонд ежедневно на протяжении всего исследования (16 недель), в то время как имитационные и контрольные группы ежедневно получали деминерализованную воду. Количество используемых бактерий было основано на предыдущем исследовании [7]. Бактерии B. longum были приобретены в Американской коллекции типовых культур (ATCC 15707; Роквилл, Мэриленд, США) и были активированы три раза подряд в бульоне MRS (De Man Rogosa and Sharpe, Difco, Детройт, Мичиган, США). изменено с 0.02% карбонат натрия, 0,01% дегидрат хлорида кальция и 1% раствор 0,05% L-цистеина, как описано ранее [7].

2.4. Биохимический анализ крови, эвтаназия и отбор проб

В конце вмешательства крыс анестезировали комбинацией ксилазина и кетамина. Кровь собирали путем пункции сердца, после чего животных подвергали эвтаназии. Кровь помещали в простые пробирки, а затем центрифугировали при 3000 об/мин в течение 10 мин при 4°C для получения сыворотки для дальнейшего анализа.Содержание кальция и магния в сыворотке крови измеряли с помощью анализатора Roche Cobas C-311 Japan (Hitachi, Япония). OC и CTX анализировали с использованием стандартного коммерческого набора ELISA, Rat-MID OC EIA (IDS, Fareham, UK) для OC и RatLaps EIA (IDS) для CTX. Бедренные кости осторожно удаляли и сохраняли в 10% забуференном формалине для дальнейших анализов. Для выделения РНК правую бедренную кость немедленно перенесли в RCL2 (Alpheys, Plaisir, Франция) и хранили при -80°C до дальнейшей оценки.

2.5. Оценка содержания минералов в костях

Содержание кальция, магния и цинка в бедренной кости определяли с помощью атомно-абсорбционной спектрофотометрии (novAA 400; Analytik Jena, Йена, Германия) в соответствии с ранее описанной процедурой [23] с небольшими изменениями. Сначала бедренные кости сушили при 105°C в течение 24 часов, а затем помещали в муфельную печь при 550°C еще на 24 часа для получения образцов золы. Затем золу измельчали ​​и гидролизовали 6M HCl. Содержание кальция определяли при длине волны 422.7 нм и токе лампы 4,0 мА, содержание цинка определяли при длине волны 213,9 нм и токе лампы 2,0 мА, магния – при длине волны 285,2 нм и токе лампы 2,0 мА.

2.6. Микро-КТ (
мкм -КТ) Анализ

Изображения бедра каждой крысы были получены после вскрытия с использованием мкм -КТ (SkyScan, 1176, Brukler-Micro CT, Kontich, Бельгия) при разрешении 35  мкм м, фильтр 0,5, экспозиция 100, напряжение 40, ток 100. Для улучшения качества изображения перед сканированием и во время реконструкции проводилась коррекция жесткости луча.Затем изображения бедренной кости были реконструированы с помощью программного обеспечения NRecon версии 1.6.3.3 и проанализированы с использованием программного обеспечения анализатора SkyScan CT версии 1.9.1 для измерения BMD (гр/см 3 ), процентного отношения объема кости к общему объему (BV/TV%) , трабекулярная толщина (Tb.Th) (мм), трабекулярное число (Tb.N) (мм −1 ), трабекулярное расстояние (Tb.Sp) (мм) и процент общей пористости (к.про%) . Калибровку анализатора мкм -CT проводили с фантомным материалом из гидроксиапатита кальция (CaHA) размером 4 мм попарно, концентрации 0.25 и 0,75 г/см 3 , и их коэффициент затухания (AC).

2.7. Оценка физических и биомеханических свойств бедренной кости

Вес бедренной кости измеряли с помощью цифровых электронных весов (Marte-AS 2000C, Сан-Паулу, Бразилия). Расстояние от верхнего края головки до нижнего края, как длину бедренной кости, и окружность средней точки, как толщину бедренной кости, измеряли с помощью штангенциркуля из нержавеющей стали. Разрывную силу бедренной кости оценивали методом трехточечного изгиба по Goda et al.[24] в центре бедренной кости с использованием универсальной испытательной машины (Instron Ltd., 8874, High Wycombe, UK), оснащенной датчиком нагрузки 5 KN.

2.8. Оценка гистологии костей

Формалин, в котором были зафиксированы бедренные кости, периодически заменялся до проведения гистологических измерений. Первую половину каждого образца левой бедренной кости подвергали декальцинации в 5% азотной кислоте в течение 24 часов. Затем образцы переносили в автоматический вакуумный процессор тканей (Leica ASP 300, Wetzlar, Германия) для обезвоживания.Затем образцы заливали в парафиновый гистологический воск и делали срезы толщиной 6  мкм мкм с использованием микротома (Leica, Wetzlar, Германия). На заключительном этапе образцы срезов окрашивали гематоксилином и эозином (H&E) и исследовали под световым микроскопом (микроскоп Olympus BX51TRF-CCD, Токио, Япония). Статические параметры, включая поверхность остеобластов/поверхность кости (ObS/BS), поверхность остеокласта/поверхность кости (OcS/BS), поверхность эрозии/поверхность кости (ES/BS), поверхность остеоида/поверхность кости (OS/BS) и остеоид объем/объем кости (OV/BV) измеряли с использованием количественного стереологического метода гистологии, известного как метод Вейбеля [25].Все гистоморфометрические измерения проводились во вторичной губчатой ​​области, богатой трабекулярной тканью. Выбранная область располагалась на расстоянии 1 мм от латеральной коры и 3–7 мм от самой нижней точки пластинки роста [26]. Гистоморфометрические измерения костей были проанализированы в соответствии с рекомендациями Комитета по номенклатуре гистоморфометрии Американского общества исследований минералов костей (ASBMR) [26].

2.9. Выделение РНК и ПЦР в реальном времени

РНК экстрагировали из замороженной правой бедренной кости крыс с использованием мини-набора HiYield Total RNA (Real Biotech, Тайбэй, Тайвань) в соответствии с инструкциями производителя.Затем сообщали о выходе РНК в соответствии с поглощением при 260 нм с использованием NanoDrop ND-1000 UV-Vis (NanoDrop Technologies, Уилмингтон, Делавэр, США). Качество РНК оценивали, используя коэффициент поглощения при 260/280 нм вместе с коэффициентом поглощения 260/230 нм. Экстрагированную РНК использовали только тогда, когда коэффициент поглощения при А260/230 и А260/280 показывал значения от 1,8 до 2,0 со специфическими полосами при гель-электрофорезе [27]. Затем РНК обратно транскрибировали в кДНК с использованием набора для синтеза кДНК i-script (Bio-Rad, Мюнхен, Германия) в соответствии с инструкциями производителя.ОТ-ПЦР в реальном времени проводили в реакционной смеси, содержащей 3  мкл л кДНК в общем объеме 25  мкл л на реакцию с 2x SYBR Green I Hot-Start ПЦР-микс в реальном времени. Затем амплификацию проводили в термоциклере с использованием системы Eppendorf Realplex (Eppendorf, Гамбург, Германия) с начальной денатурацией при 95°C в течение 15 мин, затем 40 циклов при 95°C в течение 15 с, 58,6°C в течение 40 с, и 68°С в течение 20 с. Данные представлены как кратность изменений относительно гена домашнего хозяйства.

Прямой и обратный праймеры были разработаны на основе последовательностей, полученных из баз данных ENA и GenBank (http://www.ncbi.nlm.nih.gov/tools/primer-blast/): Bmp-2, регистрационный номер NM_017178, прямой праймер: CAGGTCTTTGCACCAAGATG и обратный праймер: GCTGGACTTAAGACGCTTCC; Sparc , номер доступа NM_012656, прямой праймер: CAGGTGGAAATGGGAGAGTT и обратный праймер: GTTTGCAATGATGGTTCTGG; и глицеральдегид-3-фосфатдегидрогеназа (GADPH) в качестве гена домашнего хозяйства, номер доступа NM_017008, прямой праймер: TCAAGAAGGTGGTGAAGCAG и обратный праймер: AGGTGGAAGAATGGGAGTTG.Праймеры были поставлены Helix Biotech (Helix Biotech Ltd., Ричмонд, Британская Колумбия, Канада). Затем праймеры разбавляли до конечной концентрации 100  мк л водой, не содержащей нуклеаз.

2.10. Подсчет бифидобактерий в фекалиях

После добавления пробиотиков свежие фекалии крыс культивировали в агаре Bifidus Selective Medium (агар BSM, Fluka, Buchs, Швейцария) и бифидобактерии подсчитывали после инкубации. Планшеты с культивируемыми бактериями помещали на 72 ч при 37°С в анаэробный сосуд для обеспечения анаэробных условий газовым баллоном (Oxoid Ltd., Бейзингсток, Великобритания). После периода инкубации колонии подсчитывали с использованием устройства для подсчета колоний (Stuart Scientific, Стаффордшир, Великобритания) и количество колоний выражали как .

2.11. Статистический анализ

Данные были проверены на нормальность с использованием процедуры UNIVARIATE программного обеспечения SAS (версия 8.2, SAS Institute Inc., Кэри, Северная Каролина, США). Микробные данные были преобразованы и представлены в виде сырой массы. Данные анализировали с помощью однофакторного дисперсионного анализа (ANOVA) с PROC MIXED в SAS.Результаты выражали как среднее значение ± стандартная ошибка среднего, а различия между группами анализировали с помощью апостериорного критерия Тьюки. Значимость рассматривалась при .

3. Результаты
3.1. Влияние
B. longum на массу тела

В конце исследования масса тела крыс из групп, которым вводили имитацию, OVX и B. longum , составляла   г,   г и   г соответственно. . Достоверной разницы между группами не наблюдалось ().

3.2. Эффект
Б.longum по биохимическому анализу крови и содержанию минералов в костях

Параметры сыворотки приведены в таблице 2. У крыс OVX без добавления B. longum наблюдалось значительное снижение уровня остеокальцина в сыворотке (OC; ; ) по сравнению с имитацией (; ) и B. longum -дополненные группы (; ). Овариэктомия повышала уровень СТХ в сыворотке по сравнению с группой симуляции (более ;), что указывало на повышенную активность резорбции кости. Однако группа, получавшая B. longum , показала снижение уровня CTX в сыворотке (; ) по сравнению с группой OVX.Уровни Ca и Mg в сыворотке (Таблица 2) и содержание минералов в бедренной кости, включая Ca, Mg и Zn (мг/г) (Таблица 3), не были существенно затронуты добавками B. longum ().

параметры сыворотки значение

Sham OVX OVX + В. лонгум

OC (нг / мл) 184,61 ± 6,93 a 76.81 ± 6,44 с 101,31 ± 9,21 б 0,001
СТХ (нг / мл) 113,77 ± 20,02 б 249.28 ± 7.57 147,05 ± 6,25 б 0,009
Са (ммоль / л) 2,27 ± 0,12 2,23 ± 0,12 2,27 ± 0,06 0,939
Mg (ммоль / л) 0,97 ± 0,07 0,89 ± 0,09 0.91 ± 0,06 0,751

Тен-недельного возраста самка Sprague-Dawley крыс с добавлением 1 мл B. лонгум (10 8 -10 9  КОЕ) один раз в день в течение 16 недель, начиная со 2-й недели после операции, в то время как в группах с имитацией и OVX получали 1 мл деминерализованной воды. В конце исследования сыворотку крови крыс анализировали на остеокальцин (ОК), С-концевой телопептид (СТХ), кальций (Са) и магний (Mg).Значения представляют собой среднее значение ± стандартная ошибка среднего (SEM) (в каждой группе).
abc Значения с разными буквами в одной строке значительно различаются на основе однофакторного дисперсионного анализа с последующим апостериорным тестом Тьюки.
значение

Бедренное содержания минеральных веществ (мг / г) Ш OVX OVX + В. лонгум

Ca 246.23 ± 10,14 242,09 ± 5,16 242,45 ± 15,26 0,280
Мг 33,23 ± 0,15 32,44 ± 0,12 32,76 ± 0,31 0,220
Zn 17,23 ± 2,04 13,89 ± 0,67 13,96 ± 1,25 0,241

Ten-West Spere Sprague-D-D-Dawley
Ten-West Wome Sprague-D-Dawley
Ten-West Spresemed D-D-D-Dawley
Ten-Week Sprague-D-Dawley

Ten-Week Of Beeekeded 40004 40004 40004 .longum (10 8 –10 9  КОЕ) один раз в день в течение 16 недель, начиная со 2-й недели после операции, в то время как группы имитации и OVX получали 1 мл деминерализованной воды. В конце исследования было проанализировано содержание кальция (Ca), магния (Mg) и цинка (Zn) в бедренной кости. Значения представляют собой среднее ± SEM (в каждой группе).
На основе однофакторного дисперсионного анализа с последующим апостериорным тестом Тьюки не наблюдалось значительных различий между группами.
3.3.
Б.longum Увеличение МПК и изменение трабекулярной структуры бедренной кости

Реконструкция μ -КТ изображений бедренной кости показана на рисунке 1. МПК (г/см 3 ), BV/TV (%), общая пористость (%), Tb.N (мм -1 ), Tb.Th (мм) и Tb.Sp (мм) были измерены с использованием анализатора мкм -CT и представлены в таблице 4. OVX уменьшил процент BV/TV () и Tb.N () () и увеличенный процент общей пористости (; ). Добавка B. longum увеличивала BV/TV% и Tb.N и снизили общую пористость в %, отменив эффект OVX. Кроме того, добавка B. longum повышала уровень Tb.Th почти так же, как в группе симуляции. В связи с этим группа OVX показала наименьшее количество Tb.Th по сравнению с группой, получавшей фиктивный и B. longum (, , и, соответственно; ). Настоящая добавка также увеличивала МПК бедренной кости по сравнению с группой OVX (по сравнению с ;). Существенных изменений Tb.Sp бедренной кости между группами не было.

б AB 974 3 94

Параметры Подделка OVX OVX + B.лонгум значение

BV / TV (%) 73,66 ± 6,45 49,60 ± 5,69 б 60,55 ± 3,57 AB 0,025
Пористость (%) 24,84 ± 5,45 44,25 ± 3,98 34,85 ± 2,25 0,026
Tb.Th (мм) 7,33 ± 0,65 4.83 ± 0,27 B 7,21 ± 0,48 A 0,004
TB.SP (MM) 5,48 ± 0,42 5,3077 5,48 ± 0,42 5,30 ± 0,377 5,48 ± 0,42 5,30 ± 0,37 70073 5,48 ± 0,42 5,30 ± 0,37 70078 5,48 ± 0,42 , .N (мм −1 ) 0,12 ± 0,01 A 0,10 ± 0,01 B 0,09 ± 0,01 AB 0,040
0,040
7. .
0,040
0,040
0,040
1,06 ± 0,02 а 0.59 ± 0,07 B 0,89 ± 0,06 A 0,013

DEN-WEEK-LED-WeekED-SpeekEdED 9003 с Speek-SpeekEdED 9003 9003. 9007-DAWEREDED 9003 9003 9003. longum (10 8 –10 9  КОЕ) один раз в день в течение 16 недель, начиная со 2-й недели после операции, в то время как группы имитации и OVX получали 1 мл деминерализованной воды. В конце исследования рассеченные бедра были проанализированы с помощью анализатора микро-КТ.Значения представляют собой среднее ± SEM (в каждой группе).
BV/TV: объем кости/общий объем; Tb.Th: толщина трабекулы; Tb.Sp: трабекулярное разделение; Tb.N: трабекулярное число; BMD: плотность костной массы.
ab Значения с разными буквами в одной строке значительно различаются на основе однофакторного дисперсионного анализа с последующим апостериорным тестом Тьюки.
3.4. Влияние
B. longum на физические и биомеханические свойства бедренной кости

Вес, высота и толщина бедренной кости существенно не различались между группами (таблица 5).Однако OVX снижал прочность бедренной кости (0,54 ± 0,09) по сравнению с имитационной группой (0,90 ± 0,12; ). Добавка B. longum увеличивала прочность бедренной кости (;) (рис. 2).


значение

бедренной кости физические характеристики Шам OVX OVX + В. лонгум

Вес (г) 1.06 ± 0,03 1,09 ± 0,05 1,10 ± 0,04 0,842
Высота (мм) 37,28 ± 0,75 37,36 ± 0,41 37,37 ± 0,22 0,989
Толщина (мм) 4,05 ± 0,16 4,17 ± 0,09 4,17 ± 0,07 0,721



. .longum
(10 8 –10 9  КОЕ) один раз в день в течение 16 недель, начиная со 2-й недели после операции, в то время как группы имитации и OVX получали 1 мл деминерализованной воды. В конце исследования вес бедренной кости измеряли с помощью цифровых электронных весов, а высоту и толщину измеряли с помощью штангенциркуля из нержавеющей стали. Значения представляют собой среднее ± SEM (в каждой группе).
На основе однофакторного дисперсионного анализа с последующим апостериорным тестом Тьюки не наблюдалось значительных различий между группами.

3.5. Влияние
B. longum на остеобласты, остеокласты, остеоид и эрозированную поверхность на поверхности кости бедренной кости

Остеокласты, остеобласты и остеоидные клетки, а также на эродированную поверхность показано на рисунке 3. Кроме того, гистоморфометрические результаты, в том числе ObS/BS, OcS/BS, ES/BS, OS/BS и OV/BV суммированы в таблице 6. По сравнению с имитационной группой, OVX снизил ObS/BS (), OS/BS (18,08 ± 0,17), и OV/BV (7,06 ± 0,30) и повышенный OcS/BS (27.96 ± 0,33) и ЭС/БС () (). Добавка B. longum значительно увеличила ObS/BS (), OS/BS () и OV/BV () и снизила OcS/BS () и ES/BS () по сравнению с группой OVX ().

+
значение
Параметры (%) Шам OVX OVX + В. лонгум

OBS / BS 53,30 ± 2.29 и 37.05 ± 0,44 с 46,85 ± 1,42 б 0,046
OCS / BS 23,01 ± 1,34 с 27,96 ± 0,33 25,54 ± 1,23 б 0,001
OS / BS 24,02 ± 1,27 18,08 ± 0,17 с 23,06 ± 1,19 б 0,034
О.В. / BV 13,33 ± 1,28 7.06 ± 0,30 с 10,15 ± 1,19 б 0,004
ES / BS 28,97 ± 2,15 с 37,78 ± 0,30 34,24 ± 1,25 б 0,001

ДЕРЕВИДНАЯ ЖЕНЩИНА SPRAGUE-DAWLEY Крысы были дополнены 1 мл B. Longm4 (10 8 –10 3. в течение 16 недель, начиная со 2-й недели после операции, в то время как группы имитации и OVX получали 1 мл деминерализованной воды.В конце исследования определяли процент поверхности остеобластов/поверхности кости (ObS/BS), поверхности остеокластов/поверхности кости (OcS/BS), поверхности эрозии/поверхности кости (ES/BS), поверхности остеоида/поверхности кости (OS). /BS), а объем остеоида/объем кости (OV/BV) измеряли на окрашенных H&E срезах рассеченной бедренной кости. Значения представляют собой среднее ± SEM (в каждой группе).
abc Значения с разными буквами в одной строке значительно различаются на основе однофакторного дисперсионного анализа с последующим апостериорным тестом Тьюки.
3.6. Влияние
B. longum на экспрессию костного морфометрического белка-2 ( Bmp-2 ) и секретируемого белка, кислого и богатого цистеином ( Sparc ) генов

5 900mp 2 Экспрессия гена показана на рисунках 4 и 5. Sparc и Bmp-2 были значительно снижены в группе OVX (), а добавка B. longum значительно повышала экспрессию Sparc (кратность изменений; ) и Bmp-2 (кратность изменения) по сравнению с группой OVX.



3.7. Подсчет бифидобактерий в образцах фекалий

Общее количество бифидобактерий в фекалиях показано на рисунке 6. Добавление B. longum значительно увеличивало общее количество бифидобактерий (КОЕ/г) в фекалиях группы, получавшей добавки ().


4. Обсуждение

В конце исследования все группы показали одинаковую массу тела, как и ожидалось, поскольку три диеты, использованные в этом исследовании, были изокалорийными, а потребление пищи было одинаковым во всех группах.Этот результат согласуется с предыдущим исследованием Bryk et al. [28]. В этом исследовании B. longum может увеличить количество бифидобактерий в фекалиях крыс и увеличить плотность костной массы, предполагая, что профилактическое действие B. longum на остеопороз может быть связано с его пробиотическими эффектами.

Остеопороз сопровождается снижением МПК и изменениями микроструктуры костной ткани в виде снижения Tb.Th, Tb.N и BV/TV% и увеличения Tb.Sp, общая пористость и риск перелома костей. Эти характеристики остеопороза наблюдались в группе, не получавшей добавки OVX, в настоящем исследовании. Аналогичные результаты были получены в предыдущих исследованиях [29, 30]. Добавка B. longum снизила Tb.Sp и общую пористость бедренной кости и, параллельно, увеличила Tb.N, Tb.Th и BV/TV и привела к улучшению МПК бедренной кости. Действительно, трабекулярная микроструктура и BV/TV являются основными детерминантами перелома кости и прочности кости и имеют положительную связь с потерей костной массы [31].Снижение прочности кости снижает эластичность кости, а потеря эластичности кости связана с переломом кости [32]. Таким образом, Tb.Th, Tb.N и Tb.Sp, а также BV/TV являются некоторыми предикторами риска переломов костей и остеопороза, которые в этом исследовании модулировались добавлением B. longum . Фактически, аналогичные результаты относительно изменений трабекулярной микроструктуры при употреблении пробиотиков были также получены Чиангом и Паном [7] и Шимом и соавт. [33].

В данном исследовании B.longum снижал резорбцию кости и увеличивал костеобразование, на что указывало увеличение OC и снижение уровней CTX в сыворотке, а также изменение соотношения ObS/BS, OS/BS, OcS/BS и ES/BS. Для непрерывного процесса ремоделирования кости необходимы как остеобласты, так и остеокласты. Остеокласты растворяют костный матрикс, что приводит к возникновению эрозионной поверхности [1], но одновременно с этим происходит костеобразование с помощью остеобластов. CTX в сыворотке вырабатывается остеокластами в процессе резорбции кости и является маркером резорбции кости, в то время как OC в сыворотке секретируется только клетками остеобластов и остеоцитов во время формирования кости и является маркером формирования кости [34].Так, усиление процесса костной резорбции сопровождается повышением активности остеокластов и повышением уровня СТХ в сыворотке, а усиление процесса костеобразования — повышением активности остеобластов и уровня ОХ в сыворотке [35]. , 36]. Таким образом, активность клеток остеокластов и остеобластов можно оценить путем измерения OC и CTX в сыворотке [37] и оценки отношения поверхности остеобластов и остеокластов к поверхности кости. Повышение уровня СТХ в сыворотке крови и соотношения OSc/BS и ES/BS в трабекуле, имевшее место у крыс OVX, свидетельствовало о том, что костно-резорбционная активность предшествует процессу костеобразования.В настоящем исследовании добавление B. longum снижало соотношение OSc/BS и ES/BS и уровни CTX в сыворотке, в то же время увеличивая соотношение ObS/BS, OS/BS и OcS/BS и уровни в сыворотке OC, что указывает на его благотворное влияние на здоровье в качестве пробиотика для предотвращения остеопороза.

Кроме того, добавка B. longum увеличивала экспрессию Bmp-2 и Sparc . Bmp-2 является фактором роста и играет существенную роль в развитии скелета, особенно в раннем эмбриогенезе [38], и хорошо известен как сигнал формирования кости [39] и выступает в качестве ключевого агента в дифференцировке остеобластов [40] .Кроме того, Bmp-2 — ген, контролирующий как пролиферацию, так и дифференцировку остеобластов [41]. Повышение экспрессии Bmp-2 приводило к увеличению секреции Bmp-2 в клетках. Следовательно, остеобласты могут регулировать собственную пролиферацию и дифференцировку, что играет ключевую роль в ремоделировании кости. С другой стороны, Bmp-2 также может способствовать регенерации и восстановлению костей и предотвращать апоптоз [42]. Регенерация кости связана с эластичностью кости и связана с прочностью кости [43].Следовательно, увеличение прочности бедренной кости за счет пробиотических добавок в текущем исследовании может также быть связано с более высокой экспрессией Bmp-2 . В связи с этим Kanakaris et al. [40] показали, что лечение остеопоротических переломов с помощью Bmps вызывало быстрое увеличение прочности кости во всем скелете, особенно в области перелома кости. Другим геном, исследованным в этом исследовании, является Sparc , который кодирует неколлагеновый белок внеклеточного костного матрикса, необходимый для кальцификации коллагена в кости [44].Недавнее исследование изучало терапевтический эффект Sparc для лечения или профилактики заболеваний, связанных с костями. Это связано с ремоделированием тканей, развитием восстановления и минерализацией костей [45]. Поскольку Sparc участвует в ремоделировании кости и является кальций-связывающим рецептором, а также способствует кальцификации костей [46], увеличение его экспрессии приводит к усилению кальцификации костей, что приводит к укреплению костей, как это наблюдалось у крыс OVX, получавших B. longum . Таким образом, активация Sparc может объяснить увеличение прочности костей, вызванное B.добавка лонгум .

Повышенное количество бифидобактерий в фекалиях крыс продемонстрировало повышенную колонизацию кишечника и слепой кишки этими бактериями и свидетельствовало о том, что клеточная стенка бактерий была неповрежденной после прохождения через желудочно-кишечный тракт (ЖКТ), а бифидобактерии, использованные в этом исследовании, устойчивы к кислотам и желчи ЖКТ [47]; это помогает бактериям выжить при прохождении желудочно-кишечного тракта, чтобы лучше функционировать [48]. Как правило, пробиотики оказывают значительное влияние на желудочно-кишечный тракт, улучшая пролиферацию эпителиальных клеток кишечника за счет увеличения продукции короткоцепочечных жирных кислот (КЦЖК) [49].Производство SCFA снижает pH просвета, впоследствии увеличивает абсорбцию минералов [50] за счет их солюбилизации и уменьшает вторичное образование кислоты в толстой кишке [17]. Таким образом, всасывание Са из кишечника увеличивается за счет выживания и функциональности пробиотиков в ЖКТ. В этом исследовании добавка B. longum вызывала повышение уровня кальция в сыворотке, активировала Sparc и повышала содержание кальция в бедренной кости по сравнению с группой, не получавшей OVX.Таким образом, добавка B. longum в качестве пробиотика уменьшала потерю костной массы, вызванную OVX. Кроме того, некоторые исследования показали, что химиотерапия у крыс вызывала потерю костной массы [51, 52], поскольку наши результаты показали, что Bifidobacterium longum может предотвратить потерю костной массы у крыс; таким образом, он может быть применим для крыс, проходящих химиотерапию.

Это исследование не лишено недостатков. В связи с этим были некоторые ограничения, о которых можно говорить. Во-первых, в этом исследовании оценивались только BMD и BMC крыс в конце исследования и сравнивались между различными группами.В исследовании не измеряли BMD и BMC крыс перед началом лечения, чтобы сравнить изменения BMD и BMC бедренной кости до и после вмешательства. Это ограничение произошло из-за отсутствия доступного инструмента перед началом вмешательства. Во-вторых, это исследование не планировало фиктивную группу с добавлением пробиотиков в качестве контроля для сравнения. Мы просто ограничиваем две группы как контрольную и одну группу вмешательства.

5. Заключение

Добавка B. longum предотвращает потерю костной массы, вызванную OVX у крыс.Наши результаты показали, что B. longum, в качестве пробиотической добавки, увеличивали образование кости, уменьшали резорбцию кости и изменяли микроструктуру бедренной кости. МПК бедренной кости была увеличена за счет активации генов Sparc и Bmp-2 . Эти данные позволяют предположить, что B. longum следует рассматривать как потенциальное терапевтическое средство для предотвращения постменопаузального остеопороза. Однако для объяснения механизма, с помощью которого B.Добавка longum влияет на результаты, описанные в этом исследовании.

Конфликт интересов

Авторы заявляют об отсутствии конфликта интересов в связи с публикацией данной статьи.

Благодарности

Авторы хотели бы поблагодарить Лаборатории биохимии и питания Факультета медицины и здравоохранения Университета Путра Малайзии (UPM) и Центр тканевой инженерии Университета Кебангсаан Малайзии (UKM) за их помощь и поддержку.

Коммерческие пробиотики на основе бифидобактерий | Ремиссия СХУ

В моем последнем посте мы обнаружили, что низкий уровень бифидобактерий характерен для многих заболеваний/синдромов, которые считаются аутоиммунными. Мы также обнаружили, что количество лактобактерий увеличивается по мере увеличения количества бифидобактерий, другими словами, они дополняют друг друга и поддерживают друг друга, при этом ключевое наблюдение заключается в том, что лактобациллы усиливают воспаление, а бифидобактерии уменьшают его. Это может объяснить плохой/неуспешный успех пробиотиков Lactobacillus при СХУ.

Хороший список доступных пробиотиков находится на сайте CandidaDiet, где показаны различные комбинации и их предполагаемое содержание . Предполагаемый? Это печальная новость.

Штаммы редко указываются в списках, и их содержимое может не соответствовать заявленному!

«Новое исследование, проведенное учеными из Калифорнийского университета, показало, что состав многих пробиотических продуктов с бифидобактериями отличается от перечисленных ингредиентов… 16 продуктов… только один продукт соответствует списку ингредиентов… Некоторые продукты также содержат виды, не указанные на этикетке» [ Источник 2015] — ОЙ!

Исследования

Критерии: исследования только с пробиотиками Bifidobacteria .(Существует пробиотик BIO-THREE, который не содержит бифидобактерий, но, по данным PubMed [2007], вызывает их увеличение — я связался с производителем по поводу розничной доступности в США)

Пробиотик Условия Исследование
Bifidobacteria infantis 35624 СХУ, язвенный колит, псориаз снижают системные провоспалительные биомаркеры как при желудочно-кишечных, так и не желудочно-кишечных заболеваниях[2013]
Штамм Bifidobacterium breve Yakult язвенный колит улучшить клиническое состояние больных ЯК [2011]
Бифидобактерии энтерококки; Бифидобактерии лактобактерии (Bifico) язвенный колит эффективен для предотвращения обострений хронического язвенного колита.[2003]
Bifidobacterium longum Y 10, B. infantis Y 1 и B. breve Y 8 (VSL-3) колит, болезнь Крона, СРК, Многие исследованияМногие исследования «доказательств использования пробиотиков при ВЗК мало. Большинство исследований ограничены дизайном или не показывают эффективности лечения пробиотиками. Только несколько рандомизированных контролируемых исследований продемонстрировали какой-либо положительный эффект от использования пробиотиков при ВЗК; а именно, использование VSL#3 у пациентов с поухитом и язвенным колитом.[2012]
Bifidobacterium breve штамм Yakult, Bifidobacterium bifidum штамм Yakult язвенный колит оказывает противовоспалительное действие против язвенного колита. [2008]

Помимо VSL-3, почти нет клинических испытаний против различных состояний. Японская компания по производству пробиотиков Yakult, по-видимому, является доминирующим игроком в этой области.

Итак, мы знаем, что низкие уровни связаны со многими состояниями, мы знаем, что то, что написано на бутылке, может не соответствовать тому, что в бутылке, почти никто не дает штаммы, мало клинических исследований…  Добро пожаловать в искусство пробиотики.😦

Я составил таблицу видов и коммерческих продуктов ниже, чтобы хоть как-то ориентироваться. В общем, я бы не рекомендовал что-либо, содержащее L. Acidophilus.

Эмпирические правила:

  • Выберите вариант с наибольшим количеством видов B. по разумной цене (т. е. ежемесячная стоимость/вид)
  • Замените пробиотики, когда вы прикончили бутылку.
  • Старайтесь получать разные виды при каждой смене

— Ключевые слова из таблицы/изображения выше

NOW Foods Acidophilus/bifidus ProBiota Bifido Life Extension Bifido GI Balance Align Natren Bifido Factor Dairy Free Flora Baby Klaire Labs Ther-Biotic Factor 4 Nestle Beba ProNature Made Пищеварительные пробиотики Advance Dual Support Active Balance Высокоэффективный пробиотик Bayer TruBiotics CVS Пищеварительные пробиотики Pearls Elite Florajen 3 Kyo-Dophilus Good FloraLife Start 2 Nature Made Тройной пробиотик Nature’s Way Primadophilus Intensive Philips Colon Health Probioplus DDS Five Strain

  • Bifidobacterium animalis
  • Бифидобактерии бифидум
  • Bifidobacterium breve
  • Bifidobacterium infantis
  • Бифидобактерии лактис
  • Бифидобактерии лонгум

 

Нравится:

Нравится Загрузка…

Родственные

Бифидобактерии и микробиота кишечника | История HRB

Важность сбалансированной микробиоты кишечника

Бифидобактерии: основные представители кишечной микробиоты человека

Бифидобактерии, наряду с лактобациллами, являются наиболее распространенными видами пробиотиков.Несмотря на некоторые общие свойства, бифидобактерии и лактобактерии принадлежат к двум различным таксономическим группам. Бифидобактерии являются основными представителями полезных бактерий, присутствующих в кишечнике человека. Количество бактерий бифидобактерий превышает количество лактобацилл [1] в несколько сотен раз в желудочно-кишечном тракте человека, особенно в толстой кишке. На этом основании бифидобактерии рассматриваются как виды, приспособившиеся к среде кишечника человека. В то время как лактобациллы производят молочную кислоту как основной конечный продукт метаболизма сахаров, бифидобактерии производят как молочную кислоту, так и уксусную кислоту, которая полезна для здоровья человека.

Бифидобактерии Молочнокислые бактерии [1]
Морфология клеток Изогнутые, разветвленные или булавовидные стержни Бифидобактерии Кокки или палочки лактококк лактобактерии
Среда обитания В основном толстый кишечник человека и животных Обычно молоко и молочные продукты, кишечник человека и животных, ферментированные продукты, такие как маринованные овощи
Чувствительность к кислороду Неспособны жить в присутствии кислорода (облигатные анаэробы) Способны жить в присутствии кислорода (факультативные анаэробы)
Основные метаболиты Молочная кислота + уксусная кислота Молочная кислота
  1. [1] Относится к типичным видам, принадлежащим к роду Lactobacillus
Что такое пробиотики?

Согласно Объединенной рабочей группе ФАО/ВОЗ 2002 года, пробиотики представляют собой «живые микроорганизмы, которые при введении в адекватных количествах приносят пользу здоровью хозяина» [2] .Польза пробиотиков для здоровья в основном связана со здоровьем желудочно-кишечного тракта (ЖКТ). Есть поговорка, что «здоровый кишечник – залог здорового тела».

  1. [2] Продовольственная и сельскохозяйственная организация Объединенных Наций (ФАО). 2001. Здоровые и питательные свойства пробиотиков в пищевых продуктах, включая сухое молоко с живыми молочнокислыми бактериями,

Колонизация бифидобактериями в кишечнике человека

Изменения в составе микробиоты кишечника с возрастом

Уровень бифидобактерий снижается с возрастом

Пробиотические бифидобактерии

могут улучшать когнитивные функции у тревожных мышейbreve

1205 может снизить тревожность у лабораторных мышей, и они продолжили это исследование в своем новом исследовании с данными, показывающими специфические эффекты штамма

«В настоящем исследовании мы показываем, что некоторые штаммы Bifidobacteria и, в частности, B. longum 1714, способны оказывать положительное влияние на когнитивные функции в когнитивных задачах, связанных со страхом, возможно, за счет снижения тревожности у мышей», — написали они в Behavioral Brain Research .

«Насколько нам известно, это одно из первых исследований, показывающих, что комменсальные бактерии могут улучшать когнитивные функции у здоровых животных (т.е. без предшествующего физиологического вмешательства, такого как кишечная бактериальная инфекция или стрессовое событие)».

Ось кишечник-мозг

Данные исследований на животных и людях показали, что пробиотики могут оказывать успокаивающее действие, и недавний обзор, опубликованный в журнале Neuropsychiatric Disease and Treatment Линхун Чжоу и Джейн Фостер из Университета Макмастера в Канаде Уингз сказал, что пробиотики и пребиотики могут изменять микробиоту кишечника и влиять на ось кишечник-мозг, чтобы, возможно, открыть новые способы воздействия на нейропсихологические состояния.

Как сообщалось на прошлой неделе в NutraIngredients-USA​, увеличение потребления ферментированных продуктов, как сообщалось, было связано с меньшим количеством симптомов социальной тревожности, особенно у людей с более высоким генетическим риском. Это исследование, опубликованное в Psychiatry Research , , считается первым отчетом, связывающим потребление натуральных ферментированных продуктов и тревогу.

Чтобы получить краткий обзор роли пробиотиков в здоровье мозга, посетите вебинар NutraIngredients с доктором Джоном Биненстоком из Университета Макмастера в Канаде: Не только о здоровье кишечника — новая волна пробиотиков.

Детали исследования

Для нового исследования ученые из Университетского колледжа Корка и компании Alimentary Health Ltd. в Корке изучили способность B. longum 1714 и B. breve 1205 изменять когнитивные процессы у взрослые самцы мышей BALB/c.

Лабораторные животные ежедневно получали добавки B. longum 1714, B. breve 1205 или контроль в течение 11 недель. Под руководством Элен Савиньяк исследователи подвергли животных серии когнитивных тестов, начиная с 4-й недели.

Результат показал, что мыши, которых кормили B. longum 1714, показали значительно лучшие результаты в тесте на распознавание объектов, чем другие, в то время как мыши, получавшие B. breve 1205, показали лучшие результаты, чем контрольные мыши.

Исследователи также подвергли мышей лабиринту Барнса, который измеряет пространственное обучение и память, и обнаружили, что мыши, которых кормили B. longum ​ 1714, делали меньше ошибок, чем другие животные, «предполагая лучшее обучение» — сказали они.

Лучшее обучение и память также продемонстрировали мыши B. longum ​ 1714, которых кормили, в тесте условного рефлекса страха.

«Новая роль кишечной микробиоты»

«Таким образом, существует большая вероятность того, что B. Longum 1714 положительно модулирует поведение BALB/c, уменьшая их тревожность», ​написали исследователи.  «Эти данные подтверждают, что эффекты комменсальных бактерий сильно зависят от штамма, но, прежде всего, бактерии и кишечная микробиота также могут влиять на когнитивные функции у невозмущенной здоровой мыши.

«Эти результаты показывают новую роль кишечной микробиоты и предлагают потенциальный терапевтический подход для лечения когнитивных нарушений, связанных со стрессовыми или нейродегенеративными заболеваниями, прежде всего, поскольку мы обнаружили доказательства положительного воздействия B. Longum 1714 на гиппокамп, одна из первых областей мозга, пораженных болезнью Альцгеймера.

«Поэтому очень интересно провести дальнейшие исследования, чтобы изучить и охарактеризовать молекулярные механизмы, лежащие в основе действия этих комменсальных бактерий на поведение.

Источник: Behavioral Brain Research
1 июля 2015 г., том 287, страницы 59–72, doi: 10.1016/j.bbr.2015.02.044
«Бифидобактерии модулируют когнитивные процессы у тревожных мышей
Авторы: Х.М. Савиньяк, М. Трамуллас, Б. Кили, Т.Г. Динан, Дж. Ф. Крайан

Здоровье кишечника: как увеличить количество бифидобактерий

Ваш врач, возможно, упомянул, что здоровье кишечника влияет на настроение, уровень холестерина, иммунитет и здоровье сердечно-сосудистой системы.Хорошим советом является сокращение потребления сахара и увеличение количества клетчатки. Однако новое исследование показало, что определенный кишечный микроорганизм оказывает сильное влияние на здоровье кишечника. К сожалению, количество бифидобактерий-чемпионов с возрастом значительно снижается. Ученые нашли противоядие: пробиотик под названием ксилоолигосахариды (XOS). Прием очень малых доз XOS увеличивал популяцию бифидобактерий в кишечнике.

Как бифидобактерии влияют на здоровье кишечника

Пищеварительная система человека зависит от большого разнообразия микроорганизмов.Эти крошечные помощники помогают пищеварению. Однако некоторые микроорганизмы в кишечнике оказывают негативное влияние на общее состояние здоровья. Исследования показывают, что правильный баланс кишечных микроорганизмов имеет решающее значение для хорошего здоровья. Здоровье кишечных бактерий связано с дегенерацией желтого пятна.

Бифидобактерии — одна из многих «хороших» бактерий в кишечнике. Их достаточное количество помогает иммунитету, уменьшая воспаление. Исследования указывают на то, что этот микроорганизм защищает от сердечных заболеваний, диабета, инфекций, рака и аллергии.

Как улучшить здоровье кишечника

Общие рекомендации по улучшению баланса кишечника включают:

  • Уменьшить потребление рафинированного сахара. Рафинированный сахар питает нездоровые микроорганизмы.
  • Увеличение количества растворимой клетчатки. Ешьте больше фруктов и овощей.
  • Ежедневно принимайте пищевые добавки с клетчаткой, такие как шелуха подорожника (неподслащенный метамуцил).
  • Наслаждайтесь ферментированными продуктами, такими как йогурт, квашеная капуста и мисо.
  • Принимайте пробиотик ежедневно

Пробиотики для увеличения популяции бифидобактерий

Было показано, что пробиотик под названием ксилоолигосахариды значительно увеличивает популяцию бифидобактерий.В небольшом контролируемом исследовании испытуемые принимали XOS в крошечных количествах — 1 или 2 грамма.

Количество бифидобактерий значительно увеличилось. Чем больше испытуемые взяли, тем быстрее результаты. XOS только увеличивал количество бифидобактерий. Это не привело к увеличению популяций негативных микроорганизмов.

Результаты показали, что организм выбрасывает больше холестерина. Также повысилась кислотность стула. Кислотность препятствует росту вредных микроорганизмов.

Автор Marc_GrossmanОпубликовано

Написать ответ

Ваш адрес email не будет опубликован.