Группа крови 3 положительная совместимость при зачатии: 404 — Страница не найдена

Содержание

Группы крови — совместимость при зачатии ребенка | Парадоксов друг

Иногда потенциальные родители, подходящие к процессу зачатия ребенка ответственно, сдают анализ на совместимость группы крови, необходимую при зачатии ребенка.

Еще с совсем недавние времена, лет 100 назад, виновницей и в бесплодии, и в рецидивирующих выкидышах плода, априори, была женщина. О ней говорили, что она бесплодна. Миллионы женщин абсолютно здоровых, и способных рожать здоровых полноценных детей, были обречены на бездетность. А всего-то надо было сменить спутника жизни. К счастью для женщин, наука не стоит на месте, и теперь доподлинно известно, что в бесплодии и в выкидышах в равной мере виновны оба родителя. А точнее, не виновен никто – природа выставленные счета оставляет без внимания, она их не оплачивает.

Как группа крови влияет на совместимость при зачатии ребенка

Влияние группы крови родителей на группу крови плода следующее:

Ø Группа крови будущих родителей, в идеале, должна совпадать. В таком случае вероятность того, что группа крови ребенка будет такой же, как у родителей равна 98 %;

Ø Если у родителей группы крови разные, то ребенок может иметь с одинаковой вероятностью все четыре группы крови – I; II; III и IV. Но группа крови матери, в этом случае встречается у ребенка чаще, чем отцовская. Скорее всего, это связано с вынашиванием плода. Иммунная система матери толерантна к плоду с идентичной группой крови. А вот с отцовской группой крови может бороться, тогда беременность будет протекать неблагополучно, возможны выкидыши.

Какие же группы крови родителей не совместимы:

Ø 1(о) группа крови женщины не совместима со 2; 3; 4 группой у мужчин;

Ø 2(А) группа у женщин не совместима с 3 и 4 группой у мужчин;

Ø 3(Б) группа у женщин не совместима с 2 и 4 группой у мужчин;

Ø 4(АВ) группа у женщины совместима со всеми группами мужчины.

Влияние резус фактора крови на совместимость при зачатии ребенка

Помимо групп, кровь характеризуется еще и резус фактором, а именно наличием или отсутствием специального белка на поверхности эритроцитов:

Ø Если белок имеется (Rh+), то резус фактор положительный;

Ø Если белок отсутствует (Rh -) – резус фактор отрицательный;

Ø Есть еще один вид — слабоположительный. Он присущ не более 1% европейцев и характеризуется тем, что анализ крови иногда дает положительный, а иногда отрицательный результат. Но это скорее аномалия, нежели норма.

Влияние на плод резус фактора при беременности имеет еще большее значение, чем группа крови. Как именно влияет резус фактор крови на совместимость при зачатии ребенка:

Ø Если резус фактор родителей совпадает, не возникает никаких проблем;

Ø Если у матери резус фактор положительный, а у отца отрицательный, то проблем, скорее всего, не будет;

Ø Если же у матери отрицательный, а у отца положительный и ребенок унаследует резус отца, то возможен конфликт резус факторов. Этот чужеродный для организма матери белок будет рассматриваться ее иммунной системой, как антогонист и против плода будет предпринята иммунная атака, что приведет либо к выкидышу, либо к серьезным аномалиям у плода, вплоть до его нежизнеспособности.

Резус фактор не обязательно наследуется от родителей. Например, если и отец, и мать имеют резус положительный, то ребенок может родиться с резусом отрицательным. Причем нужно понимать, что ни один из резусов не является хуже или лучше другого. Они приобретают огромное значение при зачатии новой жизни и переливании крови. Если реципиенту перельют кровь с другим резусом, то возможен резус конфликт и отторжение влитой крови. Последствия могут быть плачевными.

Как можно повлиять на совместимость крови при зачатии ребенка.

К сожалению, предотвратить резус конфликт при зачатии и вынашивании плода для мамы, носительницы отрицательного резус фактора, при положительном резус-факторе у отца, никак не возможно. Но очень важно сдать кровь на анализ обоих потенциальных родителей перед зачатием. Кто предупрежден – тот вооружен. Необходимо знать не только все риски резус-конфликтной беременности, но и знать, как можно с ними справиться:

Ø Первая беременность при неудачном сочетании резус факторов вполне может протекать успешно, без осложнений. Ребенок может родиться абсолютно здоровым;

Ø Вторая беременность будет программировано сложной. Необходимо будет не просто наблюдаться в женской консультации, но и ежемесячно сдавать кровь на антитела.

Ø При обнаружении антител в крови матери будут проведены следующие манипуляции:

· Для исследования берется биопсия хориона для ДНК –диагностики развивающегося плода, чтобы заранее знать о развивающейся аномалии, или о ее отсутствии;

· При обнаружении антител водится иммуноглобулин. Иногда этой процедуры бывает достаточно, чтобы все наладилось, и беременность протекала успешно;

· Иногда делается внутриутробное переливание крови плоду. Эта процедура тоже, в большинстве случаев, приводит к благополучному рождению здорового ребенка;

· УЗИ матки тоже дает много информации о развитии плода при резус-конфликтной беременности. При развитии угрозы жизни матери прибегают к преждевременным искусственным родам.

Зная все риски резус-конфликтной беременности, стоит к зачатию ребенка подойти максимально ответственно. Хуже, когда беременность незапланированная, а еще хуже, когда и вовсе нежеланная. Первый аборт для женщины с отрицательным резус-фактором может поставить крест на ее материнстве. Жаль, что об этом не говорят в школах. Изучая интегралы и астрономию, люди ничего не знают об очень важных особенностях собственного тела.

Несовместимость групп крови при зачатии и совместимость крови у супругов

Группа крови – это комплекс специфических белков на поверхности красных кровяных телец (эритроцитов).

Основной системой, по которой определяют несовместимость и совместимость крови для зачатия и переливаний, является система ABO.

По этой системе выделяют 4 группы, каждая из которых имеет свою комбинацию аглютиногенов (А, В) и аглютининов к ним (a, b). Таблица ниже описывает данные о содержании этих компонентов в каждой из 4 групп.

Резус-фактор (RH) — вторая клинически значимая классификация крови после системы ABO. Ключевым антигеном является антиген D. Если он есть на поверхности эритроцита, то кровь считают резус-положительной, если нет – то, соответственно, резус-отрицательной. Большинство людей на планете, около 85% являются положительными по системе резус, оставшаяся часть будет отрицательной.

Кроме резус-фактора и системы ABO, существует еще несколько классификаций групп крови по другим антигенам. Однако значение для проверки родителей на совместимость крови при зачатии придают, в большинстве случаев, только этим двум.

Совместимость по системе ABO

Данные о группе будущей матери и отца выясняют еще на этапе планирования ребенка. В ситуациях, когда у партнеров подозревают иммунологическое бесплодие, несовместимость родителей может стать одной из причин проблемы.

Несовместимость развивается в тех случаях, если в крови одного человека находятся аглютиногены, а в крови другого соответствующие им аглютинины, например, A и a или B и b.

В этих ситуациях происходит реакция агглютинации (склеивания) и эритроциты не могут полноценно выполнять свою функцию. При зачатии плод, в большинстве случаев, наследует группу крови матери.

Таблица ниже показывает, какая может быть группа крови у ребенка, если известна группа крови обоих родителей.

Если у ребенка начинает формироваться отцовская или третья группа крови, которая несовместима с материнской, то может произойти иммунологический конфликт. В этих случаях высока вероятность развития выкидыша уже на ранних стадиях беременности. Кроме этого, такое состояние может приводить к развитию гемолитической болезни у ребенка.

Совместимость по резус-фактору

Если несовместимость по системе AB0 встречается редко, то развитие резус-конфликта наблюдается гораздо чаще. Какие обстоятельства в этом вопросе могут привести к развитию несовместимости? Если резус-отрицательная мама беременеет Rh+ плодом.

В такой ситуации белки эритроцитов плода поступают по общему кровотоку к матери. Там их встречает иммунная система, которая воспринимает эти белки как чужеродный объект. Организм женщины начинает вырабатывать защитные антитела, которые вызывают гибель эритроцитов ребенка. Это означает, что мама и плод несовместимы между собой.

Если беременность первая, то серьезных проблем обычно не возникает, поскольку иммунная система срабатывает медленно и не успевает создать достаточное количество клеток-защиты.

При повторной беременности резус-отрицательным ребенком, иммунная система женщины срабатывает гораздо быстрее. Иммунные клетки мамы вырабатываются в большом количестве и начинают убивать эритроциты ребенка.

Это приводит к кислородному, голоданию, нарушению развития и может спровоцировать внутриутробную гибель плода.

Чтобы этого не произошло, партнеров с разными резус-факторами проверяют заранее, и беременность проходит под контролем врача. Кроме этого, после первой беременности женщине вводят специальную сыворотку, которая предотвращает развитие блокирующих антител при последующей беременности.

Важно! Тяжесть проявления несовместимости по резус-фактору увеличивается при каждой последующей беременности.

О чем еще нужно помнить в такой ситуации? Развитие клеток-памяти у резус-отрицательной женщины происходит при любом контакте с резус-положительной кровью. Если у будущей мамы в анамнезе были аборты, переливания, выкидыши, то это может означать, что она уже встречалась с резус-положительной кровью. При таком анамнезе первая запланированная беременность уже находится под угрозой.

Клинический случай: Пациентка М., 26 лет, Rh-, первая беременность Rh+ плодом. Ребенок родился раньше срока на 32 неделе с тяжелой гемолитической желтухой, обширными отеками и кардиомегалией. Оказалось, женщина не помнила, что в возрасте 3 лет ей была выполнена операция с переливанием донорской крови Rh+.

В остальных случаях резус-фактор не влияет на нормальное развитие беременности. Так, если женщина Rh+, беременеет плодом Rh-, то конфликта не будет, поскольку в крови плода нет чужеродных для мамы антител.

Что такое гемолитическая болезнь?

Под этим диагнозом понимают развитие гемолитической анемии (малокровия) у плода и новорожденного в результате иммунологической несовместимости у родителей. Эта болезнь может развиться при несовместимости партнеров и по резусу, и по системе AB0, и по другим антигенам.

В этих случаях при беременности происходит гибель эритроцитов плода. Эту гибель вызывают иммунные клетки матери, которые восприняли их за чужеродный объект. Гибель эритроцитов вызывает их усиленную выработку и появление в кровотоке высокотоксичного для ребенка непрямого билирубина.

Таблица ниже показывает вероятность конфликта при различных группах крови у родителей.

Клинические проявления болезни зависят от того, какое количество антител от мамы проникло через плаценту. В самых тяжелых случаях наступает гибель плода. Могут развиться выраженные отеки, желтуха, водянка живота, увеличиваются размеры печени и сердца и др. Выделяют три степени тяжести этого заболевания, в соответствии с которыми проводят лечение ребенка.

Что делать и как предупредить несовместимость партнеров

Для того чтобы у будущих родителей не возникло проблем, девушкам нужно с огромной осторожностью относиться к абортам и переливаниям. При переливаниях существует опасность введения крови с неправильным резусом, а также всегда есть риск иммунизации по другим антигенам. Переливание должно производиться по жизненным показаниям.

В большинстве случаев иммунизация матери наступает после первых родов. В связи с этим роженице в течение суток должна быть введена специальная вакцина, которая предупредит появление проблем в будущем.

Отличия по резусу и группе крови у супругов или у будущего ребенка не должны становиться показателем глобальных проблем. Никто не будет выбирать себе супруга исходя из данных о его белках на эритроцитах. Современная медицина позволяет преодолеть эту несовместимость и контролировать реакцию организма. Чтобы это сделать, нужно внимательно относиться к своему здоровью, и соблюдать предписания доктора.

Способы проверки совместимости по крови и резусу

Редко семейные пары задумываются о таком параметре как совместимость групп крови при зачатии ребенка, поскольку попытки забеременеть в большинстве случаев успешны. Но вот когда при множественных попытках результата нет, начинают искать причины.

Одной из таких причин может быть несовместимость партнеров по группам крови или по резус-факторам. Эта проблема не столь серьезная, чтобы пары не могли забеременеть вообще.

Зачать ребенка можно даже с различными сочетаниями крови и резус-факторами, правда при несовместимости на это может потребоваться больше времени и могут быть некоторые осложнения в течении беременности.

Почему совместимость групп крови важна?

Врачами доказано, что повлиять на течение беременности может совместимость крови и резус-фактор (Rh). Если у партнеров одинаковые группы крови и резус-факторы, то такое сочетание считается идеальным и проблем в зачатии быть не должно.

Но существует опасность для ребенка, если у пары разные резус-факторы.

Поскольку резус-фактор определяется наличием белка (антиген) в кровяной клетке (эритроците), то людей, не имеющих этот белок, называют резус-отрицательными, а тех у которых он есть – резус-положительными.

И в случаях, если у матери резус-фактор отрицательный, а плоду передался положительный резус-фактор от отца, то иммунная система матери может начать вырабатывать антитела против кровяных клеток эмбриона, которые проникают в организм матери сквозь плацентарный барьер.

Это катастрофически сказывается на развитии плода – приводит к выкидышам на ранних сроках или гибели плода на поздних сроках. Также может спровоцировать гемолитическое заболевание, которое приводит к разрушению эритроцитов и появлению анемии в стадии развития эмбриона.

При этом печень увеличивается и повышается уровень билирубина в крови младенца. Именно поэтому важна совместимость по резус-фактору у пары. Несовместимость групп крови не так часто встречается и впоследствии может проявить себя как гемолитическое заболевание, но в легкой форме.

Разновидности несовместимости

Несовместимости партнёров можно разбить на несколько категорий:

  1.  Иммунная. Если резус-фактор мужчины и женщины различаются, это может привести к тому, что сперматозоид будет отторгнут. Если же женщине удается забеременеть, высок шанс, что выносить ребенка она не сможет. Поэтому необходимо проходить регулярные обследования у гинеколога на протяжении всей беременности.
  2. Генетическая. Если возникла такая несовместимость, то при развитии плода в утробе матери могут возникнуть изменения в коде ДНК. Они становятся причиной такой патологии как синдром Дауна.
  • Несовместимость по группе крови можно выявить после прохождения специального теста – посткоитального. Его проводят в момент овуляции, соблюдая строгие требования:
    На протяжении трех дней партнерам надо воздержаться от интимной близости.
  • Перед визитом к врачу, нужно выполнить все необходимые гигиенические процедуры, но не спринцеваться.
  • После соития на протяжении 30 минут надо оставаться в горизонтальном положении. Но для того, чтобы избежать потери эякулята, нужно будет подложить влажную салфетку.
  • Также необходимо наведаться к гинекологу спустя 6 часов после секса. Но не позднее 12-ти часов.

Симптомы несовместимости

Основные признаки несовместимости партнеров при зачатии:

  1.  Пара не может зачать ребенка на протяжении длительного времени (больше 1 года), при регулярном, незащищенном сексе.
  2. Проблемы с вынашиванием ребенка.

Оба эти случая – сигнал, что паре нужно обратиться к специалисту, который даст направление на лабораторные анализы. После сдачи анализа крови и спермограммы можно будет сделать выводы и сказать, что выявлена совместимость по группе крови или же партнеры несовместимы.

Практически все констатированные случаи бесплодия по этой причине вызваны небольшими разладами, которые легко устранить при помощи медикаментозного лечения. Даже если все еще будет отрицательный тест на беременность, которые вы можете купить в любом супермаркете – это еще не повод отчаиваться, ведь достижения современной медицины помогут женщине ощутить радость материнства.

Опасность резус-конфликта между плодом и матерью

Анализ крови на беременность – это далеко не единственное исследование, которое придется пройти женщине, готовящейся стать мамой. Врач внимательно следит за уровнем антител у пациентки.

Даже если у беременной резус-фактор положительный, а у будущего ребенка отрицательный — это не принесет вреда им обеим. Но если ситуация противоположная, скорее всего возникнет резус-конфликт при беременности.

Эритроциты плода могут попадать в кровь женщины, где будут признаны чужеродными и атакованы, возникает иммунная реакция. Все женщины с отрицательным резус-фактором должны вплоть до 28 недели беременности каждый месяц сдавать анализы, если срок беременности больше – сдавать их нужно каждые 2 недели.

Особое внимание врач-гинеколог должен уделить размеру печени плода. Ее увеличенные размеры – сигнал к тому, что нужно делать внутриутробное переливание крови. В некоторых случаях это может стать причиной прерывания беременности.

Поэтому совместимость групп крови для зачатия играет важную роль, ведь это часто становится причиной появления угрозы жизни будущего ребенка.

Возможные усложнения при конфликте резус-факторов

После разрушения кровяных клеток в организме плода происходит токсическое поражение систем и органов. Виной этому распад молекул гемоглобина, который находится в эритроцитах и выполняет функцию транспортировки кислорода по организму.

Токсическому отравлению организма способствует продукт распада гемоглобина – билирубин. Вначале поражается нервная система, после почки и сердце. Позже начинает накапливаться жидкость в полостях и тканях, что приводит к плохому функционированию всех органов и может привести к внутриутробной гибели эмбриона.

Именно поэтому у матерей с отрицательным резус-фактором беременность может прерваться на ранних сроках. Иммуноглобулин при беременности врачи могут назначить в случаях, когда наблюдаются проблемы с вынашиванием плода.

Несовместимость партнеров при зачатии

Люди влюбляются друг в друга, женятся, создают семью, мечтают о ребёнке… Но, к сожалению, иногда случается так, что зачать малыша у пары не получается, хотя оба супруга при этом абсолютно здоровы. Почему же это происходит?

В медицине такие ситуации называют несовместимостью при зачатии. Существуют следующие виды несовместимости:

  • иммунная — по группе крови/резусу;
  • генетическая — рождение детей с синдромом Дауна или с другой инвалидностью у абсолютно здоровых родителей.

Становится ли этот диагноз приговором для семейной пары или все-таки у супругов есть шанс зачать наследника? И что же это такое ― несовместимость при зачатии?

Причины несовместимости при зачатии

Количество бесплодных браков во всём мире увеличивается с каждым годом. В самой России приблизительно 15 процентов семейных пар не могут зачать ребёнка из-за бесплодия одного супруга или же обоих.

Причины бесплодия распределяют между обеими супругами почти поровну: одна треть случаев связана с женщинами, одна треть ― с мужчинами,  последняя треть приходится на совместные проекты (20%) и необъяснимые случаи (10%).

Исследования практикующих врачей и ученых указывают на наличие психогенных изменений и психологических травм во всех ситуациях бесплодия.

О бесплодности брака говорят тогда, когда семейная пара, которая живёт регулярной половой жизнью, не добивается желанной беременности в течение года. При этом супруги не используют ни один из видов контрацепции.

Иммунологическая несовместимость при зачатии

В таких случаях парам часто ставят неутешительный диагноз «иммунологическое бесплодие». Хотя и при таком диагнозе зачатие всё-таки возможно, но при отсутствии постоянного наблюдения врача и соответствующего лечения беременность в большинстве случаев прерывается.

В первую очередь при возникновении подозрения иммунологической несовместимости конкретной пары обследоваться необходимо мужчине, для чего придётся сдать семенную жидкость на исследование (спермограмму).

Делать это нужно в клиниках, специализирующихся на планировании семьи. Результаты этого анализа определят количество и подвижность сперматозоидов, а также дадут оценку другим не менее важным показателям спермы.

Кроме того, они подтвердят или, наоборот, опровергнут наличие воспалительных заболеваний в органах мочеполовой системы мужчины.

Так что же такое иммунологическое бесплодие?

Это значит, что иммунная система конкретной женщины вырабатывает антитела, которые уничтожают сперматозоиды конкретного мужчины. Последние исследования показывают, что примерно в 30 процентах случаев причиной бесплодности браков является именно эта форма бесплодия или так называемый фактор несовместимости.

Речь идёт о  некой аллергии на сперму мужчины, или же, как ни странно это звучит, аллергической реакции самого мужчины на свое собственное семя. Причиной этому является слишком высокое количество так называемых «антиспермальных антител», которые не дают сперматозоиду исполнить его оплодотворяющую функцию.

Образовываться они могут в организме  как мужчины, так и женщины.

Антиспермальные антитела препятствуют не только зачатию, но и влияют на  протекание беременности.

Так отчего же возникает “аллергия” на конкретного человека? И почему повышается уровень  антиспермальных антител?

Существует научное мнение о том, что риск появления этих антител у женщины прямопропорционально зависит от количества её половых партнеров. Неблагоприятным фактором могут быть и перенесённые половые инфекции.

Но всё-таки основной причиной появления в женском организме антиспермальных антител является специфическая иммунная реакция на семя определенного мужчины.

Способствуют этому и наша психика, и мозг, которые напрямую влияют на самые тонкие механизмы организма, в т.ч. и на реакции самой иммунной системы.

Наличие определённого количества этих антител в организме женщины может привести к токсикозу, самопроизвольному аборту или к задержке в развитии плода. Поэтому тест на иммунологическую совместимость обязательно нужно проходить обоим супругам.

Нередко причиной невозможности зачатия являются и дополнительные осложнения в виде двурогой матки, порока развития яичников или гипоплазии шейки матки.

Резус-конфликт и несовместимость при зачатии

Несовместимость при зачатии также возможна и при наличии разных резус-факторов у супругов. Чтобы благополучно зачать ребёнка, оба супруга должны иметь одинаковый резус-фактор крови — положительный или же отрицательный.

Если же резус-факторы разные, то возможно возникновение проблем не только при зачатии ребёнка и во время беременности, но уже и после его рождения (имеется ввиду здоровье новорождённого).

Если супруги с разными резус-факторами крови решили родить ребёнка, им обязательно нужно перед зачатием пройти курс специальной терапии, чтобы организм матери впоследствии не отторгнул плод. Следует отметить, что более здоровым ребенок рождается у той пары, где группа крови отца выше, чем у матери.

Но надежда есть всегда

Ни в коем случае нельзя отчаиваться. Даже в таких ситуациях существует достаточно высокий шанс забеременеть и выносить первенца. Однако с последующими беременностями возможно возникновение целого ряда трудностей.

В отдельных случаях иммунологический механизм организма матери может начать вырабатывать антитела против резус-фактора отца. В результате материнские антитела проникают через плаценту и начинают атаковать эритроциты плода, вызывая этим развитие у него анемии.

С генетической и с иммунологической точки зрения хорошо совместимыми считаются супруги с разными группами крови, но имеющие при этом одинаковые RH (отрицательные или положительные). А вот у супружеских пар, у которых одинаковая группа крови, но разные резус-факторы, очень большая вероятность возникновения несовместимости при зачатии.

Тест на совместимость

Если супругам долгое время не удаётся зачать малыша, им обоим необходимо пройти тест на совместимость, для чего придется сдать анализ крови и пройти другие сопутствующие исследования, которые уже назначит лечащий врач.

Но даже если в результате всех проведённых исследований и тестирований будет обнаружена несовместимость по любому фактору ― не впадайте в депрессию и не отчаивайтесь.

Помните: современная медицина находится в постоянном развитии, в постоянных открытиях, что всегда даёт потенциальным мамам большой шанс забеременеть и родить здорового малыша.

И не стоит забывать о том, что самым основным фактором для зачатия ребенка является не столько совместимость супругов, сколько наличие у них искренних чувств. Рождение долгожданного ребеночка преодолеет все препятствия!

Специально для beremennost.net Анна Жирко

Как забеременеть при несовместимости

2 голос, средняя оценка: 4,50 из 5

Трудности зачатия ребенка возникают по причине проблем со здоровьем, как с женской так и с мужской стороны. Но существует процент бесплодных браков, когда партнеры здоровы, но проблема конкретно в их союзе. Закономерно возникает пугающий вопрос: как забеременеть при несовместимости и возможно ли это?

Как забеременеть при несовместимости

Как выявляют несовместимость супругов

Итак, что может указывать на несовместимость двух людей со здоровой репродуктивной системой, т.е. на бесплодность брака:

  • Невозможность зачать ребенка.
  • Регулярно случаются выкидыши.
  • Плод гибнет внутри матери.
  • Ребенок рождается нежизнеспособным.

Обращаться к врачу рекомендуют супругам, не достигшим результата в течение года, при условии регулярной близости. Существуют специальные для выявления причины неудачных попыток стать родителями. Исследования включают в себя ряд анализов: сдача крови, семенной жидкости, мазок, гормоны, а так же анализы, которые подбираются индивидуально в клинике.

При проблемах со здоровьем, в т.ч. в случаях бесплодия, важно выслушать мнение нескольких докторов, досконально изучить проблему и варианты лечения.

Чаще встречается вид иммунологической несовместимости, резус конфликт, реже – генетической. Прежде чем ответить на вопрос о лечении и вариантах выхода из ситуации, разберемся в значении названных видов бесплодия.

Что такое иммунологическая несовместимость?

Про иммунологическую несовместимость говорят тогда, когда анализы показали наличие антиспермальных антител (АСАТ), в мужском или женском организме.

В таком случае у мужчин антитела не дают сперматозоидам развиваться, а у женщин – клетки иммунитета встречают семя мужчины в качестве вредоносного объекта, подлежащего уничтожению (склеивания спермы, отторжение плода). АСАТ у женщины могут быть реакцией на конкретного партнера.

Причины наличия АСАТ: травмы и операции мужских органов, воспалительные процессы и гормональные нарушения у женщин, а также присутствие половых инфекций у супругов и др.

Несовместимость резус-факторов и групп крови

Выделяют такой вид иммунологической несовместимости как резус-конфликт. Положительный резус-фактор – белок в красных кровяных тельцах, отрицательный резус-фактор – отсутствие белка в кровяных тельцах. Резус-фактор передается по генам.

Опасность возникает у партнеров, если будущая мама с отрицательным резусом, папа – с положительным и ребенок наследует резус отца. Таким образом, эритроциты плода поступают в кровь мамы, образуют у нее резус антител и возникает иммунологический конфликт, т.е.

гемолитическая болезнь плода, разрушающая эритроциты.

Интересно, что в первую беременность резус-конфликт можно миновать, так как он невысок, а вот последующие вынашивания детей попадают в зону риска и усиленного врачебного наблюдения.

Можем говорить о наступлении резус конфликта, когда у супругов с разным резус-фактором состоялось зачатие, но беременность была прервана, антитела уже выработаны и следующее оплодотворение они встретят агрессивнее.

Имеет сходство с резус-конфликтом конфликт группы крови, но его течение проще, наблюдают у женщин с первой группой крови, вынашивающих младенцев с другой группой.

Причина конфликта заключается в первой группе крови – это единственная группа, не имеющая в своем составе А и В антигенов.

При встрече с незнакомыми для первой группы антигенами второй, третей и четвертой групп, начинается их устранение и, вследствие, конфликт. Такая ситуация может возникнуть с нарушением целостности плаценты либо во время родов.

Бесплодие 3. Индивидуальная несовместимость и иммунология.Топ 6 Самых основных причин бесплодия. Как забеременеть?Группы крови — причины несовместимостиТест на генетическую совместимость супругов

Становясь на учет в больнице, женщины в положении сдают анализ на группу крови и резус-фактор.

Что такое генетическая несовместимость?

Вид генетической несовместимости больше относят к трудностям вынашивания младенца, нежели оплодотворения. Если беременность срывается на ранних сроках путем выкидыша, замирания, а затем ситуация повторяется снова и снова, нужно обследоваться у врача-генетика. Если у супругов присутствуют похожие гены по HLA-системе, говорят об их несовместимости.

Название HLA — аббревиатура английских слов «человеческие лейкоцитарные антигены», т.е. набор генов с разными биологическими функциями. Чем больше они разнятся у потенциальных родителей, тем лучше, иначе эта система антигенов, узнавая личные измененные клетки, в т.ч.

оплодотворенную яйцеклетку, посылает сигнал иммунитету о необходимости их уничтожения. Это одна из причин, почему близкородственные связи имеют негативные последствия, схожие антигены не дают запуститься иммунитету и защитить плод.

Почему происходит совпадение у партнеров, не являющихся родней, ответить трудно.

Что могут предпринять несовместимые пары?

Отвечая на вопрос супругов: можем ли мы забеременеть при наличии несовместимости, доктора чаще отвечают утвердительно, поскольку данное направление развивается постоянно. В зависимости от поставленного диагноза лечение назначают персонально, при помощи медикаментов или хирургическим способом.

Лечение при конфликте групп крови

Для предотвращения непоправимых осложнений нужно постоянно исследовать кровь беременной женщины, что позволит контролировать появление в ней антител, называемых гемолизинами. Если гемолизины обнаруживаются – наблюдение усиливается, а их возрастание – повод для преждевременных родов или переливания крови в утробе.

Лечение резус-конфликта

После обнаружения у матери отрицательного резус-фактора, отец ребенка сдает такой же анализ. Когда выясняется, что резус мужчины положительный, возникает необходимость тщательного контроля над образованием у матери антител против резус-фактора.

Метод лечения зависит от периода возникновения и степени развития конфликта, чем быстрее он выявлен и устранен, тем более велика вероятность появления здорового человечка на свет.

В тяжелых случаях, для поднятия гемоглобина, используют вариант замены крови младенца на кровь с отрицательным резусом внутриутробно.

Применение препарата иммуноглобулина на 28 неделе сокращает развитие конфликта, также используют в течение трех суток после родов и прекращения беременности.

Лечение при наличии антиспермальных антител

Способ лечения заключается в том, что можно полгода исключать прямое контактирование во время близости с помощью средств контрацепции (презерватива) и таким образом остановить выработку антител. После этого промежутка времени появляется шанс на зачатие.

Еще один способ преодоления проблемы невынашивания – введение в кровь женщины лейкоцитов партнера, проводится для того, чтобы сосредоточить на них враждебность организма. Это дает оплодотворенной яйцеклетке нормально развиться или подготавливает условия для зачатия. Дальнейшее наблюдение у доктора не исключается.

Если проведено исследование, в ходе которого выявлена повышенная кислотность слизи шейки матки, губительно действующая на семенную жидкость, то кислотность корректируется. С этой целью часто назначают препараты антигистаминного действия. Есть вариант введения сперматозоидов в матку искусственным путем, минуя негостеприимную среду слизи. Процедура проводиться в больничных условиях.

Лечение генетической несовместимости

Генетическую несовместимость научились преодолевать пару десятков лет тому назад, это не повод опускать руки. Тогда часть плоти партнера вшивали беременной жене, что направляло внимание иммунитета на незнакомую часть кожи, сохраняя таким образом ребенка.

Есть специальные препараты для регулирования случаев частичной генетической несовместимости. Курс может быть назначен и жене и мужу. Параллельно предлагается очищение крови, ослабление женского иммунитета.

Когда устранить проблему не получается, выходом может стать экстракорпоральное оплодотворение (ЭКО). Практика применения ЭКО растет, даря шанс, казалось бы, в ситуациях безысходности. У данного метода ряд нюансов и рассматривается он только при наличии форм бесплодия у мужчин и женщин, не поддающихся лечению.

В руках грамотных врачей устраняются диагнозы, казавшиеся недавно приговорами. Сказать себе: мы можем, набраться терпения и следовать предписаниям доктора стоит того, чтобы познать радость рождения здорового карапуза.

Несовместимость партнеров при зачатии ребенка: причины, признаки, симптомы, последствия, лечение. Как определить несовместимость супругов для зачатия генетическую, биологическую, иммунологическую, по группе и резусу крови, микрофлоре?

Статья расскажет вам о том, что такое несовместимость партнеров при зачатии.

Что такое несовместимость партнеров и супругов при зачатии ребенка: причины, признаки, симптомы

В случаях, когда мужчина и женщина не могут иметь ребенка, виноватой практически в 30-35% является их несовместимость друг с другом. Именно несовместимость является основной причиной бесплодия пары. Задумываться о том, что это бесплодие является вашей проблемой, следует, если партнеры не могут завести ребенка в течение 1 года, несмотря на регулярные попытки.

В таких случаях мужчине и женщине следует заняться медицинским обследованием, чтобы исключить наличие некоторых заболеваний воспалительного и инфекционного характера. Не лишним будет сделать осмотр у врача на предмет аномалий анатомического строения внутренних половых органов.

Что может повлиять на несовместимость партнеров:

  • Генетическая несовместимость
  • Иммунологическая несовместимость
  • Биологическая несовместимость
  • Иммунная несовместимость
  • Несовместимость по микрофлоре
  • Несовместимость по группе крови

Причины бесплодия

Что такое генетическая несовместимость партнеров, супругов при зачатии ребенка?

Причиной бесплодия пары может быть генетическая несовместимость партнеров. Этот резонанс случается достаточно часто и явный, характерный и главный признак этой проблемы – отторжение плода, т.е. зачатие происходит, но беременность срывается.

Генетическая несовместимость и ее причина находится в крови, ведь для того, чтобы плод успешно прижился, у мужчины и женщины должен быть одинаковый резус фактор (+ или -). Зачатие, вынашивание и рождение ребенка у пар с разными резус факторами может произойти, но такие дети часто имеют серьезные проблемы со здоровьем.

Как забеременеть, если с мужем генетическая несовместимость?

Как уже говорилось, зачать ребенка при наличии генетической несовместимости пара может, но для того, чтобы прошло успешно и можно было избежать проблем со здоровьем, женщина и мужчина должны находится под пристальным вниманием врачей.

При обнаружении генетического «резус-конфликта» (у матери и ребенка), врачи вводят женщине специальное вещество – иммуноглобулин. Еще один способ помочь женщине выносить плод – делать периодические переливания крови. Помните, что эту проблему врачи давно научились преодолевать, паре важно лишь соблюдать четкие рекомендации.

Генетическая предрасположенность к благополучному зачатию
Генетический «конфликт» в вынашивании плода

Что такое иммунологическая (биологическая) несовместимость супругов при зачатии ребенка, как лечится?

Причинами бесплодия у здоровой матери и отца могут быть иммунологические особенности организма. Объяснить эту особенность подробно и детально не сможет ни один врач, ведь женское тело по каким-то своим особенным причинам начинает вырабатывать антитела, которые губительно воздействуют на мужское семя (сперматозоиды), убивая их.

ИНТЕРЕСНО: С другой стороны, бывают случаи, когда мужской организм самостоятельно начинает вырабатывать антитела к своим половым клеткам.

В обоих случаях сперматозоид просто не способен оплодотворить женскую клетку и спровоцировать зачатие. Существуют редкие случаи, когда беременность начиналась, но иммунные клетки женщины губили зародыша на самых ранних этапах его развития.

Что происходит при биологической несовместимости:

  • Женщина переживает сильный токсикоз
  • Беременность может самопроизвольно сорваться
  • Зародыш отстает в развитии (или вовсе замирает)

ВАЖНО: Перед тем, как начать планировать ребенка, современные репродуктивные клиники советуют парам пройти тестирование на наличие антиспермальных тел (те самые антитела).

Биологическая несовместимость — проблема на пути к зачатию

Как забеременеть, если с мужем иммунная несовместимость?

На данный момент проблема иммунной несовместимости не изучены полностью по сегодняшний день. Известно лишь то, что негативная реакция организма женщины на мужские клетки возникает при первом контакте и произойти это может с абсолютно любой парой.

ИНТЕРЕСНО: В некоторых случаях такое отторжение мужских клеток происходит на почве психологического стресса (боязнь беременности или детей, к примеру).

Реже иммунная несовместимость спровоцирована гормональными нарушениями в организме женщины, как периодическими, так и хроническими. Для того, чтобы избежать проблем с планированием беременности и патологиями развития плода, следует проходить специальные тесты и дополнительные исследования перед зачатием.

Совместимость мужчины и женщины в планировании ребенка

Что такое несовместимость супругов при зачатии ребенка по микрофлоре, как она лечится?

У каждого человека есть своя микрофлора в половой системе (баланс полезных бактерий). Помимо бактерий там так же могут присутствовать и патогенные микроорганизмы (микробы), которые могут препятствовать благоприятному зачатию. Количество данных микроорганизмов регулирует иммунная система и потому если у женщины она слабая, то зачать ей будет сложно.

ВАЖНО: Если у пары будет несовместимость микрофлор, это будет явная угроза зачатию, ведь пока она существует, иммунная система будет всячески протестовать зачатию.

Заметить симптомы патогенной микрофлоры вы сможете сразу после полового контакта:

  • Жжение в паху
  • Зуд в паху
  • Неприятный кислый запах из наружных половых органов.
  • Странные слизистые выделения, которые могут быть обильными.
  • Частые молочницы у женщины

ВАЖНО: Бесплодие на почве нарушенной микрофлоры женщины или мужчины обнаруживается всего в 3% случаев и она успешно лечится современной медициной.

Бесплодие на почве несовместимости микрофлоры половых органов

Как забеременеть, если с мужем несовместимость по микрофлоре?

Нарушенная и патогенная флора очень редко становится причиной бесплодия, но если такая проблема существует, ее следует незамедлительно решать. При обнаружении симптомов обратитесь к врачу за консультацией и лечением, сделайте тест на совместимость с партнером в поликлинике или частной клинике (посев).

С помощью анализа лаборатория выявит возбудителей и определить его чувствительность к медицинским препаратам, предназначенным для борьбы с ними. «Убить» патогенную микрофлору можно только путем приема антибиотиков. Важно, чтобы лечение проходили оба партнера, только тогда оно будет эффективным. После полного курса мужчина и женщина сдают повторные анализы.

Что такое несовместимость супругов при зачатии ребенка по группе и резусу крови: последствия и лечение

Несовместимость резус факторов крови – частая проблема на пути к благополучному зачатию ребенка. Резус фактор – это показатель белковых соединений в крови каждого человека. Так, к примеру, люди обладающие «антигенами» всегда обладают положительным резус фактором (документально он обозначается как Rh+). Но, если он отсутствует, то резус фактор отрицательный (обозначается как Rh-).

Идеальное соотношение резус факторов мужчины и женщины для благополучного зачатия – одинаковые у обоих партнеров. Однако, человек выбирает себе партнера не по группе крови, а «следуя зову сердца» и потому подобный «резус конфликт» встречается не редко (у матери крови «отрицательная», а у плода «положительная»).

ИНТЕРЕСНО: Статистика подсчитала и выявила, что 80% женщин во всем мире имеют Rh+ и они, следовательно, в не опасности такой проблемы, как бесплодие на почве «резус конфликта».

Но не спешите расстраиваться, ведь эта проблема вполне решаема современной медициной.

Состояние женщины регулируется специальной терапией, специалисты тщательно проводят анализы крови и делают тесты для пары, планирующей беременность.

Кроме того, на данный момент существует специальный препарат, который регулирует блокирование антител иммунитетом женщины и потому благополучное вынашивание вполне реально.

Резус-конфликт в планировании беременности

Проверка на совместимость партнеров для зачатия: как делать?

На данный момент современная медицина «далеко шагнула вперед» и имеет массу способов определить совместимость партнеров и найти средство решения проблемы бесплодия. Если вы не можете забеременеть в течение 1 года ,вам следует обратиться к врачу за обследованием и он назначит вам серию важных тестов:

  • Анализ микрофлоры
  • Анализ крови
  • Анализ гормонального фона
  • Анализ работы иммунной системы
  • УЗИ

ВАЖНО: Не бойтесь данных осмотров и лабораторных тестов, ведь они могут не только изучить ваш уровень здоровья, но и определить возможные заболевания, которые способен перенести ваш плод.

Можно ли делать ЭКО при несовместимости супругов?

О несовместимости партнеров можно судить только тогда, когда перед специалистом или врачом будет полная карта обследований и анализов мужчины и женщины (посевы, кровь, УЗИ, микрофлора, анатомические особенности, гормональный фон).

В зависимости от присутствующей проблемы врач назначает или лечение, или искусственное оплодотворение клетки (ЭКО). Чтобы затратная процедура ЭКО не была напрасной, врач внимательно изучит возможности вашего организма и скажет можно вам ее делать или нет.

Видео: «Топ 6 Самых основных причин бесплодия. Как забеременеть?»

Группа крови…Насколько это важно — 34 ответов на Babyblog

Многих молодых супругов, решившихся на зачатие ребенка, интересует вопрос, насколько важна их совместимость по группе крови для зачатия ребенка? Согласно медицинской консультации практикующих врачей-гинекологов важна не сама группа крови женщины и мужчины — будущей мамы и будущего папы, а их резус-фактор
, который желательно должен быть одинаковым.

Таким образом, чтобы не было проблем при зачатии ребенка и во время беременности, вынашивания ребенка, очень желательно, чтобы у партнеров была одинаковая не группа крови, а одинаковое значение резус-фактора.

А что такое вообще резус-фактор крови? Резус-фактор крови — это особый белок, находящийся на поверхности эритроцитов (красных кровяных телец): если этот белок есть, то резус-фактор — положительный, а если этого белка нет — это резус-фактор — отрицательный. Вот что такое резус-фактор крови.

Так, если у женщины резус-фактор крови отрицательный, то желательно, чтобы и у мужчины резус-фактор тоже быть отрицательным. Если у женщины резус-фактор крови положительный, то ради благополучного зачатия и беременности, желательно, чтобы у мужчины тоже был положительный резус крови.

Кстати, на заметку будущим родителям: в 99% случаев ребенок наследует и группу крови, и резус крови матери — т.е. полностью наследует характеристики материнской крови. А проблемы при зачатии ребенка и беременности, и потом — уже после рождения ребенка, возникают именно тогда, когда резус-фактор крови матери отличается от резус-фактора крови отца.

Также проблемы со здоровьем ребенка возникают, если он вдруг (такое, к счастью, бывает редко) унаследовал группу крови и резус-фактор, отличающиеся от группы крови и резус-фактора матери.

Если же вдруг резус-фактор крови женщины и мужчины не совпадает, то перед зачатием необходимо обязательно провести терапию, чтобы после зачатия ребенка организм матери не отторгнул плод.

Поэтому перед зачатием ребенка — и особенно перед первой беременностью женщины — необходимо обязательно сдать анализы на определение резус-фактора и группы крови будущих родителей.

По поводу совместимости супругов и зачатия ребенка можно также добавить, что традиционно считается, что более здоровым рождается тот ребенок, у отца которого группа крови выше, чем у матери (вообще, чем выше у отца группа крови — тем лучше).

Таблица совместимости групп крови и резус-фактора для зачатия ребенка

Ниже представлено приблизительное меню для людей со второй группой крови на неделю.

Понедельник

Завтрак: гречневая каша, кефир.

Обед: горбуша, запечённая с помидорами и луком; грибы вешенки в сметане с морковью и брокколи.

Ужин: стейк из тунца с гарниром из брюссельской капусты; овощной салат со спаржей.

Перекус: ореховое ассорти.

Вторник

Завтрак: отварные яйца; ржаные хлебцы с льняным маслом; ананасовый сок.

Обед: жареный морской окунь в кисло-сладком соусе; овощи на гриле.

Ужин: отварное филе трески с овощным соусом; салат из морской капусты.

Перекус: фрукты, арахис.

Среда

Завтрак: ячневая каша; овсяное печенье; вишневый сок.

Обед: отварное куриное филе в томатном соусе по-итальянски;

мексиканский овощной салат.

Ужин: карп, запеченный с гречневой кашей; морковь и цукини на гриле; шпинат.

Перекус: ягоды.

Четверг

Завтрак: тыквенная каша с кукурузной крупой; абрикосы; зеленый чай.

Обед: индейка тушеная с овощами, кунжутом и соусом терияки; лук, грибы и морковь на гриле.

Ужин: запеченная форель с лимоном; зеленый горошек с морковью и зеленью.

Перекус: фрукты.

Пятница

Завтрак: овсяная каша; йогурт; морковный сок с сельдереем.

Обед: отварное куриное филе с острым ананасовым соусом; гречка с жареным луком и помидорами.

Ужин: запеченный минтай с соком лимона; салат с жареными кабачками, помидорами и яйцами.

Перекус: арахис, фрукты.

Суббота

Завтрак: творог с фруктами; хлебцы ржаные; сливовый сок.

Обед: морепродукты, тушеные с луком и специями; салат с рисом и огурцом.

Ужин: котлеты из щуки в томатной подливе; брокколи с овощами на гриле.

Перекус: ягоды.

Воскресенье

Завтрак: кукурузная каша с овощами; соевое молоко.

Обед: цыпленок на гриле с овощами; кресс салат с огурцом, укропом и зеленым луком.

Ужин: запеченная горбуша с овощами; обжаренная цветная капуста с яйцами.

Перекус: фрукты, орехи или тыквенные семечки.

Группы крови, совместимость для зачатия

Беременность – ответственный этап, к которому нужно подойти со всей серьезностью за будущее состояние ребенка, для чего необходимо проходить весь комплекс медицинских обследований во избежание угрозы, как и для матери, так и для малыша. Очень важным показанием при сдаче анализов является группа крови совместимость для зачатия, определяющая резус-фактор у супругов. Полученные сведения немаловажны для нормальной беременности на протяжении всех семестров, а также для положительного состояния малыша. При совпадении показаний резус-факторов, шансы выносить и родить здорового ребенка значительно увеличиваются.

Можете, например, почитать нашу статью «какая совместимость с 3 положительной группой крови«. Думаю, вы примерно поймёте, о чём идет речь и как выглядит этот весь процесс.

Положительные показания резус-фактора свидетельствуют о своеобразном белке в эритроцитах, тогда как его отсутствие говорит об отрицательном резус-факторе. Благополучное материнство происходит при наличии у пары либо отрицательных, либо положительных показаний резус-факторов. Если медицинские обследования выявили группы крови совместимость для зачатия и совпадение резус-факторов, отцу и матери можно не волноваться о протекании беременности и состоянии ребенка. При несоответствии резус-факторов у супружеской пары, стоит, как можно раньше обратиться к врачу для приема медпрепаратов во избежание различных осложнений. Отсутствие лечения и наличие конфликта резусов угрожает прекращением беременности, так как антитела в женском организме будут пытаться уничтожить плод. Если у матери наличие крови меньше, чем у отца, группы крови и резус-факторы у супругов совпадают, шансы на благоприятное протекание беременности и рождения здорового малыша возрастают во много раз.

Совместимость группы крови для зачатия ребенка

При несоответствии у супругов резус-факторов, развивается резус-конфликт. Только при постоянном медицинском обследовании можно будет избежать различных осложнений, угрожающих состоянию будущей матери и здоровью малыша. Около трех процентов женщин имеют совместимость групп крови с наличием конфликта резусов при зачатии. В таких случаях, врач назначает постоянные анализы для обнаружения антител в женском организме, что предохранит от следующих негативных последствий: прерывание беременности, выкидыш или преждевременные роды. Однако не стоит затягивать с обследованием и серьезным подходом к данной проблеме, так как неокрепший организм ребенка активно пытается произвести красные кровяные тельца, постоянно разрушающиеся из-за вырабатываемых антител в теле матери.

При отсутствии надлежащего медицинского ухода, антителам удается сломить силы еще несформированного плода, что приводит к сложным заболеваниям у малыша, в первую очередь развитие которых сказывается на деятельности мозга, слуха и речи. Шансы к вынашиванию и рождению здорового ребенка без осложнений, высоки у женщин, на раннем сроке обратившихся в гинекологию, и всю беременность наблюдающихся у специалистов. При выявлении развивающегося конфликта резусов, врач предлагает беременность прекратить.

Данная информация будет немало полезна будущим родителям, желающим родить крепкого малыша. Супружеской паре необходимо знать о влиянии совместимости крови и резус-факторов на протекание беременности и благоприятные роды. Не стоит паниковать и беспокоиться даже при вероятности развития конфликта резусов, так как вера, любовь и сильное желание иметь здорового ребенка способны совершить чудо!

Совместимость групп крови для зачатия, совместимость по резус фактору


В медицинских институтах студенты изучают на лекциях, какие группы крови несовместимы. Эти знания жизненно необходимы при переливании плазмы и во время беременности. Несовместимость может привести к летальному исходу пациента или развитию патологий у новорожденного ребенка.

Как определяют группу крови?

Знать группу крови необходимо в следующих ситуациях:

  • при планировании беременности;
  • при переливании;
  • при подготовке к операции.
  • Определять показатель следует в медицинских учреждениях. В поликлинике по месту жительства можно сделать анализ бесплатно. Для этого требуется направление от терапевта. Результаты готовятся в течение 2-3 дней. Частные клиники проводят забор крови платно, но сроки ожидания, как правило, меньше.

    Для анализа требуется 2 порции крови из вены. Алгоритм определения группы одинаков для взрослого и новорожденного. На сегодня используется метод АВ0. А и В — особые липиды, которые называются агглютиногенами. В каждую порцию анализа добавляют один липид. Выявление антител определяет группу крови пациента.

    Таблица группы крови, позволяющая расшифровать значения:

    ЛипидынетАВАВ
    Группа1 (0)2 (А)3 (В)4 (АВ)

    Резус-фактор определяют после взбалтывания крови в центрифуге. Наличие белых хлопьев говорит о Rh+, в противном случае — Rh-.



Совместимость групп крови

При переливании важно знать, какие группы крови несовместимы. Универсального типа нет. Но в некоторых случаях человеку допустимо переливать кровь другой группы. Существуют особенности совместимости человеческой крови:

  1. Первая подходит всем остальным, а человек, обладающий четвертой, может принимать все остальные виды крови.
  2. Первая, несмотря на свою универсальность, несовместима с другими. Это означает, что для переливания людям с другими типами ее можно использовать, но другие виды переливать человеку с 1 группой недопустимо.
  3. Первая — самая распространенная на планете.
  4. Вторую используют для людей со второй и четвертой группой крови, но принимать они могут только свою и первую.
  5. Третью переливают пациенту с третьей и четвертой группой.
  6. Для человека с четвертой группой в качестве донорской подходит любая кровь.
  7. Четвертая является самой редкой группой.



Правила переливания

Переливание плазмы от человека к человеку получило широкое распространение в XX веке благодаря развитию медицины. Сейчас плазму научились консервировать, чтобы обеспечить ее длительное хранение. В организм пациента вводят свежезамороженную плазму. Переливание связано с определенными рисками для жизни пациента. Чтобы свести к минимум риск возникновения побочных эффектов, следует соблюдать правила проведения процедуры:

  • процедура проходит в стерильных условиях;
  • следует убедиться в группе пациента, чтобы исключить несовместимость по группе крови;
  • требуется выявление резус-фактора;
  • материал должен быть обследован на заболевания, передающиеся от человека к человеку;
  • введение крови в организм за один раз не должно превышать 500 мл.
  • плазма должна храниться и транспортироваться с соблюдением условий хранения;
  • необходимо провести пробу на индивидуальную совместимость;
  • для новорожденных переливание проводится с учетом индивидуальной дозировки.


  • Совместимость групп крови для переливания

    Таблица группы крови, определяющая совместимость при переливании, указана ниже. Но не все столь однозначно. Во время гемотрансфузии следует учитывать резус-фактор.

    ГруппаМожет приниматьМожет отдавать
    111,2,3,4
    21, 22,4
    31, 33,4
    41, 2, 3, 41

    Первая группа не имеет антигенов А и В на эритроцитах, но в плазме крови они присутствуют. По этой причине носители первой группы не принимают другую плазму. Пациенту, имеющему положительный резус-фактор, можно переливать первую с любым резус-фактором.

    Совместимость первой группы крови с другими группами не совсем верна. Врачи отдают предпочтение той, которой обладает пациент. Если выбора нет, и требуется ввести 1 группу, то отдают предпочтение отрицательной или цельной. Сыворотку не используют, т. к. она провоцирует слипание эритроцитов у пациентов с другими типами.

    Пациенту со второй группой крови и положительным резус-фактором проводят гемотрансфузию вне зависимости от резуса донорской плазмы. Если пациент имеет отрицательные показатель, то вводят плазму с отрицательным резусом.

    Человеку с третьей отрицательной для переливания используют отрицательную кровь. При этом сами пациенты могут стать донорами для 3 и 4 группы независимо от резус-фактора.

    Четвертая положительная группа крови подходит реципиенту с такой же кровью, а отрицательную можно вводить независимо от резуса.

    Плюсы и минусы

    К особенностям группы крови A (2) относят то, что люди, являющиеся ее носителями, имеют крепкую иммунную систему, которая позволяет эффективно бороться с бактериями и вирусами. Наиболее полезный тип питания для них — вегетарианство. Характеристика людей с группой А2:

    • медлительные;
    • слабовольные;
    • добросовестно относящиеся к своему делу;
    • исполнительные;
    • осторожные;
    • любят анализировать.

    В профессиональной деятельности люди со 2 отрицательной группой крови, а также положительной пытаются добиться высшей цели. Но к недостаткам таких людей относят то, что они в случае возникновения проблемы не обращаются за советом, а переживают стресс в одиночку. Мужчины и женщины любят порядок, спокойствие и гармонию.

    Важная информация: Особенности (характеристики) мужчин и женщин с 4 (четвертой) группой крови с положительным или отрицательным резусом

    Они часто бывают донорами, но свое здоровье нередко подрывают неправильным питанием. Существует специальная диета для таких людей, но ее несоблюдение ухудшает качество крови. К преимуществам представителей с группой A (2) относят то, что у них сильные органы мочеполовой системы и печень. Недостатки: предрасположенность к болезням щитовидной железы, гастритам, заболеваниям сердца, кариесу.

    Индивидуальная несовместимость

    Переливание крови несет риск для пациента. Врач должен знать, какие группы крови несовместимы для переливания, и вводить пациенту верный вид плазмы. Существует понятие индивидуальной несовместимости, при которой правильно подобранная группа крови не принимается организмом пациента. Для исключения подобной ситуации перед переливанием следует провести тест на индивидуальную совместимость. Для этого используют 2 способа:

    1. Из крови пациента берут 5 мл и запускают в центрифугу, куда капают каплю донорской жидкости. Наблюдают за реакцией в течение 5 минут. Если не образовались лишние антитела, то кровь можно использовать.
    2. Непосредственно в вену реципиента вводят небольшое количество донорской крови. Первый раз вводят несколько миллилитров, спустя 3 минуты процедуру повторяют. Если на какой-то стадии появляется отрицательная реакция, то для переливания ищут другого донора. При положительном тесте пациенту вводят необходимое количество крови.

    Проверка на совместимость

    Гемотрансфузии проводили еще несколько веков назад. Некоторые опыты приносили ожидаемый результат, другие — заканчивались неудачно. Тогда не могли это объяснить, но в начале 20 в. узнали о различиях в составе биологических жидкостей. Оказалось, что не каждая кровь подходит другому человеку. Универсальной группой крови считается первая отрицательная. При отсутствии совместимости переливание может окончиться летальным исходом.

    Различия основываются на наличии разных типов антигенов, которые находятся в кровяных форменных элементах — эритроцитах. На их поверхности могут находиться антигены типа А, В или отсутствовать. Если в организм попадает донорский материал, в котором содержатся антигены, отсутствующие у пациента, эритроциты склеиваются, и кровь сворачивается.

    Перед тем как приступить к переливанию, необходимо убедиться, что кровь подойдет пациенту. Для этого проводят пробы, во время которых смешивают биологические жидкости и оценивают наличие процесса склеивания эритроцитов. Чтобы снизить вероятность осложнений до минимума, реципиенту вливают небольшое количество донорской жидкости, 10-15 мл, и наблюдают за его состоянием. При фиксировании нежелательных реакций, таких как жар, одышка, тахикардия, процедуру по переливанию не проводят.

    Важная информация: Характеристика мужчин (женщин) с 2 (второй) положительной (отрицательной) группой крови

    Совместимость для зачатия

    При планировании беременности следует учитывать, какие группы крови несовместимы для зачатия. Этот показатель не влияет на вероятность зачатия, но может стать камнем преткновения во время вынашивания беременности.

    Матьотец1234
    1+
    2++
    3++
    4++++

    Резус-фактор оказывает влияние на здоровье ребенка, течение беременности и риск невынашивания. Эти проблемы объясняются тем, что при наличии у матери отрицательного, а у ребенка положительного резус-фактора, организм вырабатывает вещества, разрушающие белки плода. В дальнейшем это приводит к склеиванию и полному разрушению эритроцитов. Такую особенность называют резус-конфликтом матери и плода, при этом не имеет значения, какие группы крови несовместимы для беременности.

    При первой беременности этот процесс происходит медленно и часто не оказывает влияния на плод. Но вынашивание второго ребенка с конфликтом может закончиться развитием гемолитической болезни новорожденного, выкидышем или преждевременными родами. Матерям, имеющим отрицательную группу крови, после первой беременности вводят антирезусный глобулин, чтобы разрушить иммунологическую цепь и остановить выработку антирезусных тел.

    Современная медицина успешно справляется с резус-конфликтом матери и плода медицинскими препаратами. Женщине приходится чаще посещать гинеколога и в некоторых случаях проводить время в стационаре.

    Что имеет значение?

    По мнению гинекологов и результатам многочисленных исследований, несовместимость показателей группы крови у партнеров при планировании беременности не имеет особого значения. Это скорее миф, который активно распространяется среди молодых пар и не имеет медицинского подтверждения.

    А вот различие резус-факторов действительно имеет значение в процессе планирования беременности. В идеале он должен быть одинаков у будущих родителей.

    Резус-фактор – это особый вид белка, который располагается на поверхностном слое эритроцитов. Если этот белок присутствует у человека, тогда резус-фактор считается положительным. В случае отсутствия белка, показатель является отрицательным. Что касается статистических данных, то 85% обладает положительным значением, а для оставшихся 15% характерен отрицательный показатель.

    Поэтому при зачатии несовместимость показателей групп крови имеет не настолько важное значение, как совпадение по резус-фактору. Для благополучного планирования будущего малыша показатель обоих родителей должен быть одинаковым.

    Если же он отличается, тогда под угрозу ставится не только успешное зачатие и вынашивание малыша, но и возможность появления проблем у крохи уже после рождения. Так, в случае когда ребенок наследует папин резус-фактор, не совпадающий с маминым, то у него очень вероятно будут проблемы со здоровьем в будущем.

    Резус-фактор

    Наличие еще одного антигена характеризуется резус-фактором. Зная, какие группы крови несовместимы, следует учитывать сочетание резус-факторов. Большая часть населения имеет положительный. Всего 15% людей имеют отрицательный резус-фактор. В их клетках не содержится антиген. Резус-фактор передается по наследству независимо от группы крови отца и матери.

    Если у родителей резус отрицательный, то во время беременности конфликт исключен. При этом кровь ребенка тоже будет отрицательной. При других ситуациях предугадать резус ребенка не представляется возможным.

    Конфликтная беременность встречается нечасто в связи с небольшим процентом женщин, имеющих отрицательную группу крови.

    Как влияет на характер человека

    Группа и резус-фактор крови определяют характер человека. При рождении ребенок получает не только генетическую информацию от двух родителей, но и тип крови, который не меняется на протяжении всей жизни.

    К особенностям характера людей со второй положительной группой крови относят склонность к экономии, бережливость, умение грамотно организовывать свое дело, работать на земле и вести домашнее хозяйство. Они любят комфортную и благополучную обстановку и не терпят резких перемен. Такие люди отличаются упрямством и чрезмерной консервативностью. Они хорошо идут на контакт со всеми.

    Если у мужчин тип крови 2 A, то они в будущем будут примерными семьянинами. Это романтические натуры, верные, нежные, любящие детей и оберегающие свою семью. Для них не свойственна агрессия, злость, ярость. Такие мужчины создают в семье стабильность и порядок.

    Они никогда не предадут друга и всегда придут на помощь малознакомым людям.

    Если такой тип крови у женщин, то характеризуются они подозрительностью и ревностью. Мужчин привлекают своей застенчивостью. Такие женщины становятся хорошими женами, потому что для них семья стоит на первом месте. Они отличаются верностью, спокойствием, терпеливостью, любят создавать домашний уют и вести хозяйство. У женщин недостаточно развита сексуальность, они с прохладцей относятся к интимной близости, что нередко создает недопонимание между супругами.

    Важная информация: Определение группы крови и резус-фактора методом стандартных сывороток

    Последствия резус-конфликта

    Невынашивание беременности является основной проблемой при резус-конфликте плода и матери. При тяжелом течении беременности остается риск развития у ребенка гемолитической болезни. В организме ребенка накапливается жидкость, которая образуется в результате распада эритроцитов. Симптомами этого заболевания являются:

  • анемия — из-за сбоя в формировании эритроцитов;
  • увеличение печени и селезенки;
  • желтуха новорожденного;
  • отсутствие аппетита, плохой набор веса, вялость, бледность кожных покровов;
  • кислородное голодание.
  • Высокая концентрация билирубина приводит к интоксикации организма, поражению головного мозга и нервной системы.

    Тест на совместимость партнеров при зачатии по всем факторам

     

    Бесплодие — отсутствие беременности при регулярной половой жизни без применения контрацептивов в течение одного года. По статистике, в Беларуси не могут зачать ребёнка около 15% супружеских пар. Причины бесплодия распределяются между полами практически поровну: одна треть случаев связана с мужчинами, одна треть с женщинами, а последняя треть делится между совместными проектами (20%) и необъяснимыми случаями (10%).

    Иммунологическая несовместимость при зачатии

    Несовместимость при зачатии может быть иммунологической — это происходит тогда, когда иммунитет женщины вырабатывает антитела, убивающие сперматозоиды именно того мужчины, с которым она планирует детей. По сути, это аллергическая реакция на сперму конкретного мужчины, выражающаяся в выработке избыточного количества антиспермальных антител. Причем, эти антиспермальные антитела могут вырабатываться как в организме женщины, так и в организме мужчины.

    Надо сказать, что при таких условиях беременность наступить может — но шансы, что она сохранится, крайне малы. Кроме того, нередко такому типу несовместимости сопутствуют дополнительные осложнения, затрагивающие репродуктивную систему женщины. Это может быть гипоплазия матки, двурогость матки или пороки развития яичников.

    Чтобы исключить вероятность иммунологической несовместимости при зачатии, будущие родители, планирующие малыша, должны пройти тест на иммунологическую совместимость.

    Несовместимость при зачатии по резус-фактору

    Если женщина с отрицательным резусом и мужчина с положительным пытаются зачать ребенка — велика вероятность, что у них обнаружится такого рода несовместимость. Между тем, несовместимость при зачатии по резус-фактору сильно отличается от иммунологического варианта несовместимости. В этом случае зачать и выносить первенца, соблюдая определенные меры предосторожности, вполне возможно. Риск возрастает только во время родов, когда в резус-отрицательную кровь матери попадает резус-положительная кровь отца, и иммунная система матери может начать выработку антител, направленную против резус-положительной крови. Но, как правило, в медицинском учреждении с этим риском научились справляться.

    Проблемы с несовместимостью при зачатии по резус-фактору могут возникнуть во время планирования второго малыша. в этом случае вероятность наступления беременность велика, но вот вероятность ее благополучного исхода крайне мала. Для сохранения беременности при несовместимости родителей по резус-фактору нужно будет приложить много усилий.

    Чтобы избежать неприятных сюрпризов, обоим супругам лучше сдать кровь на резус-фактор еще на этапе планирования малыша.

    Как справиться с несовместимостью при зачатии?

    Если в течение года у пары не получается зачать ребенка — прежде всего, нужно пройти тест на совместимость. Если будет выявлена несовместимость при зачатии — лечение должно подбираться в зависимости от типа несовместимости.

    Иммунологическая несовместимость может лечиться следующими способами:

    • прием антигистаминных препаратов;
    • использование презервативов в течение некоторого времени для уменьшения повышенной чувствительности организма женщины к сперме;
    • прием иммуносупрессивных препаратов, подавляющих реакции иммунитета;
    • лечение с помощью иммуностимуляторов;
    • внутриматочное введение спермы мужа.

    Какой именно метод (или комплекс методов) лечения подобрать для той или иной пары, решает врач.

    Несовместимость при зачатии по резус-фактору требует тщательного наблюдения за будущей мамой во время беременности. При малейшем намеке на резус-конфликт необходимо вводить иммуноглобулин. Обычно это делается на 28 неделе беременности и через 3 дня после рождения малыша. В крайних случаях вопрос с несовместимостью при зачатии решается с помощью переливания крови.

    Анализ группы крови | Детская больница CS Mott

    Обзор теста

    Анализы группы крови проводятся перед переливанием крови и проверкой группы крови беременной женщины. Кровь человека типизирована по определенным маркерам (называемым антигенами) на поверхности эритроцитов. Также могут быть проведены анализы группы крови, чтобы узнать, являются ли двое людей кровными родственниками.

    Наиболее важными антигенами являются антигены группы крови (ABO) и резус-антиген, который либо присутствует (положительный, +), либо отсутствует (отрицательный, -).Итак, два наиболее распространенных теста на группу крови — это тесты ABO и Rh.

    ABO тест

    Тест ABO показывает, что у людей одна из четырех групп крови: A, B, AB или O. Если в ваших эритроцитах:

    Антиген А.

    У вас кровь группы А. Жидкая часть вашей крови (плазма) содержит антитела, которые атакуют кровь типа B. Около 36% людей (36 из 100) в Соединенных Штатах имеют кровь типа A, при этом 6% имеют A-отрицательную (A-) кровь и 30% — A-положительную (A +) кровь.

    Антиген B.

    У вас кровь группы B. В вашей плазме есть антитела, которые атакуют кровь типа А. Около 11% людей (11 из 100) в США имеют кровь типа B, 2% — B-отрицательную (B-) кровь и 9% — B-положительную (B +) кровь.

    Ни антиген A, ни B.

    У вас кровь группы О. В вашей плазме есть антитела, которые атакуют кровь как типа A, так и типа B.Около 48% людей (48 из 100) в США имеют кровь типа O, у 9% — O-отрицательная (O-) кровь, а у 39% — O-положительная (O +) кровь.

    Оба антигена A и B.

    У вас кровь группы AB. В вашей плазме нет антител против крови типа A или типа B. Около 5% людей (5 из 100) в США имеют кровь типа AB, 1% — кровь AB-отрицательная (AB-), а 4% — кровь AB-положительная (AB +).

    Кровь, полученная при переливании, должна содержать те же антигены, что и ваша (совместимая кровь).Если вам сделают переливание крови с разными антигенами (несовместимая кровь), антитела в вашей плазме разрушат клетки донорской крови. Это называется трансфузионной реакцией, и она возникает сразу после переливания несовместимой крови. Реакция на переливание крови может быть легкой или вызвать серьезное заболевание и даже смерть.

    Кровь с отрицательным типом O не содержит антигенов. Его называют «универсальным донором», потому что он совместим с любой группой крови. Кровь, положительная по типу AB, называется типом «универсального реципиента», потому что человек, у которого она есть, может получать кровь любого типа.Хотя типы «универсальный донор» и «универсальный реципиент» могут использоваться для классификации крови в экстренных случаях, всегда проводятся анализы группы крови, чтобы предотвратить реакции на переливание.

    Незначительные антигены (кроме A, B и Rh), которые встречаются в эритроцитах, также могут иногда вызывать проблемы. Таким образом, они также проверяются на соответствие перед переливанием крови.

    Серьезные реакции при переливании крови сегодня редки из-за анализа группы крови.

    Тест Rh

    Группа крови Rh проверяет наличие Rh-антигена (также называемого резус-фактором) на эритроцитах.Если у вас красные кровяные тельца:

    • У вас есть резус-антиген, ваша кровь резус-положительная.
    • У вас нет резус-антигена, ваша кровь резус-отрицательная.

    Например, если у вас есть антигены A и Rh, ваша группа крови A-положительная (A +). Если в вашей крови есть B-антиген, но нет резус-антигена, ваша группа крови B-отрицательная (B–).

    Rh группа крови еще более важна для беременных. Проблема может возникнуть, когда женщина с резус-отрицательной кровью беременеет ребенком (плодом) с резус-положительной кровью.Это называется резус-несовместимостью. Если кровь резус-положительного ребенка смешивается с кровью резус-отрицательной матери во время беременности или родов, иммунная система матери вырабатывает антитела. Этот ответ антител называется резус-сенсибилизацией и, в зависимости от того, когда он возникает, может разрушать красные кровяные тельца ребенка.

    Rh сенсибилизация обычно не влияет на здоровье ребенка во время беременности, во время которой происходит сенсибилизация. А вот здоровье ребенка с резус-положительной кровью во время будущей беременности пострадает с большей вероятностью.После сенсибилизации у ребенка могут развиться проблемы от легкой до тяжелой (так называемая резус-болезнь или эритробластоз плода). В редких случаях, если не лечить резус-инфекцию, малыш может умереть.

    Тест на резус-фактор проводится на ранних сроках беременности для проверки группы крови женщины. Если у нее отрицательный резус-фактор, она может получить прививку резус-иммуноглобулина, который почти всегда предотвращает сенсибилизацию. Проблемы, связанные с резус-сенсибилизацией, стали очень редкими с момента разработки резус-иммуноглобулина.

    Почему это сделано

    Сдана группа крови:

    • Перед переливанием крови.
    • Когда женщина планирует забеременеть или впервые забеременела.
    • Перед сдачей крови.
    • Перед операцией.
    • Перед тем, как человек отдаст орган на трансплантацию.
    • Чтобы показать, могут ли двое людей быть кровными родственниками.
    • Для проверки личности подозреваемого в совершении преступления.

    Как подготовить

    В общем, вам ничего не нужно делать перед этим тестом, если только ваш врач не скажет вам об этом.

    Как это делается

    Медицинский работник использует иглу для взятия пробы крови, обычно из руки.

    Часы

    Каково это

    При взятии пробы крови игла может вообще ничего не чувствовать. Или вы можете почувствовать укол или ущипнуть.

    Риски

    В этом тесте очень малая вероятность возникновения проблемы. При заборе крови на месте может образоваться небольшой синяк.

    Результаты

    Анализы группы крови проводятся перед переливанием крови и проверкой группы крови беременной женщины. В следующей таблице показана совместимость групп крови доноров и реципиентов.

    Прочтите таблицу следующим образом: Человек, у которого кровь A-отрицательная, может получить кровь A-отрицательную или O-отрицательную.

    Соответствующие группы крови

    Лицо, имеющее:

    Можно получить:

    А-кровь

    А-, О- кровь

    A + кровь

    A-, A +, O-, O + кровь

    Б-кровь

    Б-, О- кровь

    B + кровь

    B-, B +, O-, O + кровь

    AB- кровь

    AB-, O- кровь

    AB + кровь

    AB-, AB +, A-, A +, B-, B +, O-, O + кровь

    O- кровь

    O- кровь

    O + кровь

    O-, O + кровь

    Второстепенные антигены (кроме A, B и Rh) на эритроцитах также проверяются на соответствие перед переливанием крови.

    Кредиты

    Текущий по состоянию на: 23 сентября 2020 г.

    Автор: Healthwise Staff
    Медицинский обзор:
    Э. Грегори Томпсон, врач внутренних болезней
    Адам Хусни, доктор медицины, семейная медицина
    Мартин Дж. Габика, доктор медицины, семейная медицина

    По состоянию на: 23 сентября 2020 г.

    Автор: Здоровый персонал

    Медицинское обозрение: E.Грегори Томпсон, врач внутренних болезней и Адам Хусни, доктор медицины, семейная медицина и Мартин Дж. Габика, доктор медицины, семейная медицина

    Исследование показало, что группа крови может повлиять на фертильность | Проблемы с фертильностью

    Группа крови женщины может влиять на ее шансы забеременеть, как выяснили ученые.

    Люди с группой крови O могут испытывать трудности с зачатием из-за меньшего количества яиц и плохого качества яиц, в то время как люди с группой крови A кажутся более фертильными.

    Более 560 женщин со средним возрастом 35 лет, проходящих лечение от бесплодия, приняли участие в исследовании, проводимом экспертами из Медицинского колледжа Альберта Эйнштейна в Нью-Йорке и Йельского университета.

    Были взяты образцы крови для измерения уровня фолликулостимулирующего гормона (ФСГ), известного маркера фертильности.

    Уровни ФСГ выше 10 указывают на то, что у женщины будут большие трудности с зачатием, чем у женщин с уровнем ниже 10.

    Высокий уровень ФСГ указывает на уменьшение резерва яичников, что относится как к качеству яйцеклеток, так и к количеству яиц, оставшихся для оплодотворения .

    Яичниковый резерв имеет тенденцию к значительному сокращению по мере того, как женщина достигает среднего и позднего 30-летнего возраста и быстрее в начале 40-х годов.

    Исследование показало, что женщины с группой крови O в два раза чаще имеют уровень ФСГ выше 10, чем женщины с любой другой группой крови. Результаты подтвердились, даже если принять во внимание возраст женщины и тот факт, что женщины поступили из двух разных клиник.

    Между тем, у людей с группой крови A была «значительно меньше шансов» иметь уровень ФСГ выше 10, чем у тех, кто принадлежал к группе крови O.

    Около 44% населения Великобритании относятся к группе крови O и 42% — к группе A .

    Люди с группой крови A несут антиген A, который представляет собой белок на поверхности клетки, но он отсутствует у людей с группой O.

    Доктор Эдвард Неджат из отделения акушерства и гинекологии Колледжа Альберта Эйнштейна представляет свои открытия на конференции Американского общества репродуктивной медицины (ASRM) в Денвере.

    Он сказал: «В обеих группах женщин, которые обращались за лечением от бесплодия, у женщин с группой крови O в два раза больше шансов иметь уровень ФСГ выше 10, чем у женщин с другой группой крови, чем O.

    «Мы обнаружили, что женщины с A и AB — женщины с геном группы крови A — были защищены от этого эффекта уменьшения резерва яичников. хорошее сочетание пациентов по этническому и расовому признаку, мы можем сказать, что группа крови O была связана с уровнем ФСГ более 10 у женщин, обращающихся за оценкой и / или лечением бесплодия.

    «Пациенты с группой крови O, обращающиеся за обследованием на бесплодие в эти центры, имеют более высокую вероятность того, что у них будет диагностирован повышенный уровень ФСГ и, следовательно, у них будет обнаружено снижение резерва яичников.«

    Неджат сказал, что уровни ФСГ являются лишь одним из показателей фертильности, и необходимы дополнительные исследования». Возраст женщины остается наиболее важным фактором, определяющим ее успех в зачатии.

    «Базовый уровень ФСГ дает нам представление о качестве и количестве яйцеклеток женщины».

    Тони Резерфорд, председатель Британского общества фертильности, сказал: «Я впервые знаю, что исследователи показали связь между группой крови и потенциалом фертильности».

    Однако он сказал, что существуют и другие гормоны, предсказывающие снижение резерва яичников, которые также важно оценить.

    «Это интересно, и это показывает потенциальную связь, но нам действительно нужно посмотреть на это с помощью этих других, более современных тестов яичникового резерва».

    Резерфорд сказал, что необходимо провести более масштабное исследование среди населения в целом, чтобы увидеть, вызывает ли группа крови потенциальные проблемы для всех женщин, пытающихся зачать ребенка.

    «Нам нужно посмотреть на потенциальную группу женщин, чтобы увидеть, влияет ли группа крови на ваши шансы забеременеть», — сказал он. «Это требует дальнейшего изучения.»

    Важность знания группы крови вашего ребенка

    Гены матери и отца играют важную роль в развитии их ребенка: от роста в утробе матери до группы крови. Группа крови вашего ребенка от беременности до взрослой жизни — одна из важнейших частей генетической информации, о которой нужно знать.

    Здесь мы упрощаем науку, лежащую в основе группы крови, и объясняем, почему большему количеству будущих родителей следует определять тип своего ребенка до рождения.

    Как определяется группа крови?
    Проще говоря, ваша группа крови определяется по антигенам и антителам, обнаруженным в крови. Однако определение группы крови не такое уж черно-белое, как некоторые думают.

    Во-первых, тип человека может относиться к одной из четырех основных групп крови: A, B, AB и O. Эти группы идентифицируют различные антигены, обнаруженные в эритроцитах, и антитела, обнаруженные в плазме. Например, группа крови A имеет антигены A на эритроцитах с антителами против B в плазме.

    Кровь может не только относиться к группе A, B, AB или O, но и содержать белок, называемый антигеном RhD. Этот резус-фактор определяет, является ли ваша группа крови положительной (+) или отрицательной (-) [1].

    Таким образом, всего существует 8 групп крови:
    A RhD-положительный (A +)
    A RhD-отрицательный (A-)
    B RhD-положительный (B +)
    B RhD-отрицательный (B-)
    O RhD-положительный (O +)
    O RhD отрицательный (O-)
    AB RhD положительный (AB +)
    AB RhD отрицательный (AB-)

    Как передается группа крови?
    Группы крови, составляющие группу крови человека, на 100% наследуются от родителей.Каждый родитель передает своему ребенку один из двух аллелей ABO (вариант гена). A и B — доминантные, O — рецессивные. Факторы окружающей среды означают, что вероятность передачи некоторых групп крови выше, поэтому A + является наиболее распространенным типом в Швейцарии (37%) [2].

    Чтобы нарисовать более ясную картину, в этой таблице показана потенциальная группа крови вашего ребенка на основе групп крови его родителей:

    Группа крови матери во время беременности
    Следует знать, что в редких случаях кровь матери может быть несовместима с кровью ребенка, что приводит к осложнениям, если кровь смешивается во время беременности.Эта несовместимость возникает, когда женщина с отрицательным резус-фактором рождает ребенка с положительным резус-фактором или наоборот.

    Rh Положительный — это когда белки появляются на поверхности клеток крови. Пациенты с отрицательным резус-фактором — это пациенты, которые не переносят белок. Когда женщина с отрицательным резус-фактором рожает ребенка с положительным резус-фактором, это называется несовместимостью по резус-фактору… Мама с отрицательным резус-фактором будет рассматривать резус-положительные белки, обнаруженные в крови ребенка, как чужеродные и будет вырабатывать антитела, чтобы атаковать их.

    — Джинни Харрингтон, медсестра акушерства и гинекологии

    Осложнения беременности также могут возникать из-за несовместимости по системе ABO между матерью и ребенком.Например, если у матери O +, а у ребенка A +. В этом случае смешение групп крови может вызвать у малыша желтуху.

    Чтобы выявить потенциальную несовместимость на ранней стадии, всем беременным женщинам во время беременности будет проводиться анализ крови матери.

    Почему вы должны знать группу крови вашего ребенка?
    Есть две основные причины, чтобы узнать группу крови вашего ребенка.

    Группа крови и лечение
    Самая очевидная причина связана с потенциальными чрезвычайными ситуациями.Если вашему ребенку потребуется неотложная медицинская помощь в будущем, знание его группы крови может ускорить поиск подходящего метода переливания крови. Использование неправильной группы крови во время переливания может привести к летальному исходу.

    Группа крови и здоровье в будущем
    Текущие исследования показывают, что определенные группы крови могут подвергаться более высокому риску развития определенных заболеваний [3].

    В 2012 году исследование показало, что у людей с группой крови AB риск развития сердечно-сосудистых заболеваний на 23% выше, чем у людей с группой крови O [4].

    Согласно исследованию 2014 года, люди с группой крови AB могут иметь более высокий риск инсульта, чем другие группы крови [5]. Это может быть связано с более высоким уровнем белка свертывания крови у этого типа.

    Исследование, проведенное в 2015 году, показало, что у людей с кровью типа O снижен риск развития диабета 2 типа [6].

    Американское онкологическое общество определило, что у людей с кровью типа А выше вероятность развития рака желудка по причинам, которые еще не выяснены [7].

    Что касается всех вышеперечисленных и других исследований, важно помнить, что все исследования все еще находятся на предварительных стадиях.Независимо от вашей генетической предрасположенности, выбор здорового образа жизни является ключом к предотвращению будущих болезней.

    Сдача теста на группу крови
    В Европе не во всех странах обычно проверяют группу крови вашего ребенка. Однако вы можете выбрать частный тест за небольшую плату. В Future Health Biobank мы можем определить группу крови вашего ребенка в рамках нашей службы хранения пуповинной крови, используя ваш образец пуповинной крови.

    Свяжитесь с нашей службой поддержки клиентов по телефону +41 21 948 2948 или напишите по электронной почте custcareswiss @ fhbb.com, чтобы узнать больше.

    Ссылки:
    [1] https://www.nhs.uk/conditions/blood-groups/
    [2] https://www.babymed.com/pregnancy/blood-type-and-rh-rhesus-status -countries
    [3] https://www.berkeleywellness.com/self-care/preventive-care/article/blood-type-and-your-health-there-link
    [4] https://www.ahajournals .org / doi / full / 10.1161 / ATVBAHA.112.248757
    [5] https://pubmed.ncbi.nlm.nih.gov/24444093/
    [6] https://pubmed.ncbi.nlm.nih.gov/ 25533388/
    [7] https: //www.cancer.org / рак / рак желудка / причины-риски-профилактика / риск-факторы.html

    Rh группа крови | Определение, резус-фактор и резус-несовместимость

    Система групп крови резус , система для классификации групп крови в соответствии с наличием или отсутствием резус-антигена, часто называемого резус-фактором, на клеточных мембранах красных кровяных телец (эритроцитов). ). Обозначение Rh происходит от использования крови макак-резусов в основном тесте для определения наличия Rh-антигена в крови человека.Система групп крови Rh была открыта в 1940 году Карлом Ландштейнером и А.С. Вайнер. С того времени был идентифицирован ряд различных Rh-антигенов, но первый и наиболее распространенный из них, называемый RhD, вызывает наиболее тяжелую иммунную реакцию и является основным детерминантом признака Rh.

    Rh-антиген представляет опасность для резус-отрицательного человека, у которого отсутствует антиген, при переливании резус-положительной крови. Побочные эффекты могут не проявиться при первой сдаче крови, несовместимой с резус-фактором, но иммунная система реагирует на чужеродный резус-антиген, производя анти-резус-антитела.Если после образования антител повторно сдать резус-положительную кровь, они будут атаковать чужеродные эритроциты, заставляя их слипаться или агглютинировать. Возникающий в результате гемолиз или разрушение эритроцитов вызывает серьезное заболевание, а иногда и смерть.

    Аналогичная опасность существует во время беременности для резус-положительных потомков от резус-несовместимых родителей, когда мать резус-отрицательная, а отец резус-положительный. Первому ребенку таких родителей обычно ничего не угрожает, если только мать не приобрела анти-резус-антитела в результате переливания несовместимой крови.Однако во время родов небольшое количество крови плода может попасть в кровоток матери. Затем мать вырабатывает анти-резус-антитела, которые атакуют любой резус-несовместимый плод при последующих беременностях. Этот процесс вызывает эритробластоз плода или гемолитическую болезнь новорожденного, которая может быть фатальной для плода или младенца вскоре после рождения. Лечение эритробластоза плода обычно включает одно или несколько обменных переливаний. Заболевания можно избежать, вакцинируя мать резус-иммуноглобулином после рождения первенца, если есть резус-несовместимость.Вакцина с резус-фактором разрушает все клетки крови плода до того, как иммунная система матери сможет выработать антитела.

    Хотя резус-отрицательный признак редко встречается в большинстве частей мира, он встречается примерно у 15 процентов кавказцев в Европе, Канаде и США. Наиболее часто этот признак встречается у басков Пиренеев (25–35 процентов), имазигенов (берберов) в Африке и бедуинов Синайского полуострова (18–30 процентов).

    Получите подписку Britannica Premium и получите доступ к эксклюзивному контенту.Подпишитесь сейчас

    роль преимплантационной генетической диагностики в лечении тяжелой резус-аллоиммунизации: первая незатронутая беременность: клинический случай | Репродукция человека

    Аннотация

    Резус (Rh) D-аллоиммунизация может вызвать гемолитическую болезнь плода и новорожденного, если резус-фактор плода положителен. Хотя частота тяжелой аллоиммунизации RhD снизилась при профилактическом введении анти-D иммуноглобулина во время и после беременности, сенсибилизация все еще происходит в небольшой группе женщин.У таких женщин резус-инфекция будет оставаться серьезной проблемой и для их младенцев, которые могут пострадать. Преимплантационная генетическая диагностика (ПГД) может использоваться, чтобы избежать несовместимости групп крови плода и матери у женщины с сенсибилизированным RhD. Биопсия отдельной клетки эмбрионов на ранней стадии дробления, скрининг на RhD-отрицательные эмбрионы, позволяет переносить в матку только RhD-отрицательные эмбрионы. Это позволяет избежать каких-либо осложнений, связанных с гемолитической болезнью плода и новорожденного. В этой статье описывается первый зарегистрированный случай незатронутой беременности с использованием ПГД при резус-болезни.ЭКО и перенос эмбриона привели к клинической беременности и рождению здоровой девочки, у которой была подтверждена отрицательная RhD-группа крови. ПГД в парах с гетерозиготным RhD-положительным партнером-мужчиной дает возможность избежать гемолитической болезни новорожденных у матерей с аллоиммунизацией RhD.

    Введение

    Резус (Rh) D аллоиммунизация, проявляющаяся при гемолитической болезни плода и новорожденного, может вызвать перинатальную заболеваемость, смертность и длительную инвалидность.У RhD-отрицательной женщины могут развиваться анти-D-антитела при контакте с RhD-положительным плодом во время или после беременности. Хотя различные антигены эритроцитов причастны к гемолитической болезни новорожденных, антиген RhD является наиболее распространенным и иммуногенным (NHMRC, 1999; Avent and Reid, 2000). В результате разрушения эритроцитов у плода развивается гемолитическая анемия, которая в тяжелых случаях приводит к водянке плода, внутриутробной гибели плода или к обоим сразу.

    Система групп крови Rh очень полиморфна и состоит из ≥45 независимых антигенов.Экспрессия антигена D осуществляется белком RhD, тогда как белок RhCE экспрессирует антигены C или c вместе с антигенами E или e того же белка (Mouro et al. , 1993; Blunt et al. , 1994; Avent et al. др. , 1996; Смайт и др. , 1996). Хотя белки RhD и RhCE имеют высокую степень гомологии, белок RhD не экспрессирует антигены C / c или E / e, а белок RhCE не экспрессирует антиген D.

    Белки RhD и RhCE кодируются двумя высокогомологичными генами, RHD и RHCE соответственно, которые картированы в хромосомном положении 1p34.3–1p36.13 (Cherif-Zahar et al. , 1991; MacGeoch et al. , 1992). Каждый из двух генов состоит из 10 экзонов, которые в тандеме охватывают 69 килобаз ДНК (Avent and Reid, 2000). Ген, кодирующий полипептид D, присутствует у резус-положительных людей и отсутствует у резус-отрицательных субъектов (Colin et al. , 1991).

    Примерно 57% RhD-положительной европеоидной популяции является гетерозиготной по присутствию гена RhD (Lewis et al. , 1971).Примерно 83% женщин европеоидной расы имеют RhD-положительный результат, что означает, что около 17% беременных женщин будут RhD-отрицательными. Из этих RhD-отрицательных женщин около 60% будут иметь RhD-положительного ребенка во время первой беременности (NHMRC, 1999). Если женщина станет сенсибилизированной во время первой беременности, все последующие RhD-положительные дети будут подвержены риску гемолитической болезни плода и новорожденного. У плода есть 50% шанс быть гетерозиготным резус-положительным и 50% -ный шанс быть резус-отрицательным, если резус-отрицательная женщина беременеет от гетерозиготного резус-положительного отца.В последнем случае плод сможет избежать любых потенциальных неблагоприятных последствий аллоиммунизации RhD матери.

    Тяжелая аллоиммунизация RhD сегодня встречается редко, в основном из-за разработки анти-D иммуноглобулина и его использования в клинической практике. Рекомендуется дородовая и послеродовая профилактика с помощью анти-D иммуноглобулина (NHMRC, 2003). Несмотря на явное сокращение наличия и использования анти-D среди пораженных женщин, аллоиммунизация RhD все еще имеет место (Bowman and Pollock, 1987; Crowther and Middleton, 2004).У этих сенсибилизированных женщин резус-гемолитическая болезнь будет продолжать оставаться серьезной проблемой и для их детей, которые страдают от этого заболевания.

    У женщин, которые перенесли неоднократные потери беременности, инвазивные вмешательства, такие как серийные внутриутробные переливания крови или пораженный плод или новорожденный, перспектива повторного наступления беременности со всеми ее осложнениями может показаться слишком большой. У таких женщин вместо того, чтобы рисковать родить еще одного ребенка с гемолитической болезнью новорожденного, они могут предпочесть избегать дальнейших беременностей.Даже при тщательном наблюдении за сенсибилизированными беременными женщинами для раннего выявления анемии плода и своевременного проведения внутриматочной трансфузии, существует значительная степень смертности плода (Abdalla et al. , 2004). Хотя риск гибели плода в результате кордоцентеза относительно невелик, потеря плода, связанная с процедурой, была документально подтверждена (Daffos et al. , 1985). Эти процедуры также связаны с риском потенциального увеличения продукции материнских антител к RhD из-за вторичного фето-материнского кровотечения (Nicolini et al., 1988; MacGregor et al. , 1991).

    PGD был разработан для предотвращения генетических нарушений у потомков пар из группы повышенного риска. С момента своего появления в 1990 году ПГД в основном использовалась для выявления одногенных заболеваний, таких как кистозный фиброз, или для скрининга хромосомных нарушений (Руководящий комитет консорциума ESHRE PGD, 2002). Совсем недавно появилось сообщение об использовании PGD для определения социального пола и соответствия HLA (Verlinsky et al. , 2001; Руководящий комитет консорциума ESHRE PGD, 2002).Этика такого использования выходит за рамки данной статьи и не будет обсуждаться. ПГД обязательно предполагает ЭКО. После ЭКО ранний эмбрион проверяется на наличие заболевания перед переносом соответствующего эмбриона в матку матери. При резус-болезни это позволяет переносить резус-отрицательные эмбрионы обратно RhD-аллоиммунизированной матери, избегая потенциальных осложнений и заболеваемости гемолитической болезнью плода и новорожденного.

    Хотя использование ПГД для лечения резус-болезни было опубликовано ранее, клиническая беременность до сих пор не достигнута (Avner et al., 1996). Тем не менее, PGD для генотипа Kell была успешно проведена для предотвращения тяжелой аллоиммунизации, происходящей в паре из группы риска (Verlinsky et al. , 2003). Насколько нам известно, мы сообщаем о первом случае, когда у матери с RhD-аллоиммунизацией с помощью ПГД родился здоровый RhD-отрицательный ребенок. Мы обсуждаем роль PGD в управлении аллоиммунизацией RhD в выбранных парах, где сенсибилизированная женщина и ее гетерозиготный партнер RhD могут избежать потенциальных заболеваний и смертности, связанных с RhD-положительным плодом.

    История болезни

    27-летняя замужняя женщина, сенсибилизированная RhD-антителами, обратилась за консультацией до зачатия относительно возможных вариантов попытки будущей беременности. У них с мужем было двое детей, второй из которых страдал гемолитической болезнью новорожденного. Обе эти беременности достигли срока и родились естественным путем.

    У второго ребенка развилась гипербилирубинемия и желтуха новорожденных, потребовавшая фототерапии, а также значительная гемолитическая анемия, не потребовавшая переливания крови.Пик сывороточного билирубина составил 425 ммоль / л, а самый низкий зарегистрированный уровень гемоглобина составил 75 г / л. Группа крови новорожденного была «A» RhD-положительной с положительным прямым тестом Кумба при рождении.

    Через шесть недель после родов уровень материнских анти-D-антител был повышен при количественном определении анти-D-антител 157 МЕ / мл. Уровень материнских анти-D антител оставался значительно повышенным через 6 месяцев после родов до уровня 70 МЕ / мл. Группа крови мужа была RhD-положительной, а его серологически определенным RhD-фенотипом был cDEe.Он был генотипирован и оказался RhD-гетерозиготным.

    Актуальные вопросы, касающиеся аллоиммунизации RhD и будущих потенциально более серьезных беременностей, были обсуждены с парой. Пару посоветовали, что скрининг RhD перед имплантацией с использованием PGD может позволить селективный перенос только RhD-отрицательных эмбрионов и, таким образом, избежать любой возможности несовместимости крови матери и плода при этой беременности. Пара согласилась на вспомогательную репродукцию и ПГД для переноса RhD-отрицательного эмбриона в матку.

    Женщина прошла плановую стимуляцию яичников и оплодотворение ИКСИ. Девятнадцать ооцитов были аспирированы, и 17 были пригодны для ИКСИ. В день 1 12 считались оплодотворенными. Биопсия на 3-й день, амплификация ПЦР и анализ выявили девять RhD-положительных эмбрионов, два RhD-отрицательных эмбриона и один с профилем однопородной амплификации. Два эмбриона (10-клеточный эмбрион и уплотняющаяся морула) были перенесены на 5-й день. Это привело к клинической беременности.

    ПГД выполняли с ЭКО с использованием ИКСИ (для уменьшения постороннего загрязнения ДНК), анализ ДНК отдельных биопсированных бластомеров из эмбрионов на стадии расщепления и множественная ПЦР.Олигонуклеотидные праймеры, амплифицирующие части генов RHD и RHCE, были сконструированы путем выравнивания двух последовательностей генов [идентификация доступа в GenBank NT_030571 (ген RHCE) и NT_004391 (ген RHCE)] с помощью BioManager (ANGIS, Австралия) и выбора регионов, где RHCE и RHD гены различались по длине последовательности между идентичными фланкирующими последовательностями ДНК. Было разработано в общей сложности 12 различных пар праймеров, нацеленных на разные области выравнивания, что привело бы к продукту амплификации, различающемуся по размеру между генами RHCE и RHD (Primer Express; Applied Biosystems, Австралия).После тестирования три пары праймеров дали как надежную амплификацию, так и различимые различия ампликонов и были пригодны для дальнейшего использования. Кроме того, последний мультиплекс включал два локуса с короткими тандемными повторами (STR), один из которых примыкает к гену RHCE (D1S2674), а другой немного дальше (D1S199), в качестве монитора для постороннего загрязнения ДНК и подтверждения профиля гена ( RhD-положительный или RhD-отрицательный) по сцеплению (Таблица I).

    ПГД выполняли с использованием прямой ПЦР-амплификации выделенных / нейтрализованных щелочью бластомеров с анализом капиллярным электрофорезом флуоресцентно меченных ампликонов (Cui et al., 1989). Амплификацию проводили в двухэтапной ПЦР: 94 ° C в течение 30 с и 60 ° C в течение 120 с в течение 43 циклов.

    Определены генотипы RhD 12 эмбрионов. Присутствие гена RHD в эмбрионе привело к двойному пику для каждой выбранной области амплификации; ампликон гена RHD и контрольный ампликон гена RHCE (рис. 1). В сочетании с маркерами STR точность теста для пациента может составлять> 99%.

    Регулярное ультразвуковое исследование плода на протяжении всей беременности не показало никаких признаков анемии плода или водянки плода.Материнский уровень анти-D антител также регулярно контролировался и оставался стабильным, хотя и значительно повышенным, на протяжении всей беременности (диапазон 21,0–28,0 МЕ / мл). Роды были вызваны на 39 неделе беременности. Группа крови ребенка была отрицательной по RhD «A», а прямой тест Кумба был отрицательным. Не было отмечено никаких осложнений в ближайшем неонатальном периоде или после него.

    Обсуждение

    Частота аллоиммунизации RhD снизилась после введения анти-D профилактики во время и после беременности (Bowman, 2003; Bowman and Pollock, 1987; Crowther and Middleton, 2004).Тем не менее тяжелая аллоиммунизация RhD все еще имеет место и может иметь серьезные последствия для беременности с гемолитической анемией, которая в крайних случаях вызывает заболеваемость плода, мертворождение или перинатальную смертность. После значительного нарушения беременности пары, у которых присутствует аллоиммунизация RhD, часто сталкиваются с дилеммой: пытаться ли дальнейшую беременность и с потенциальными неблагоприятными последствиями. Тенденция к ухудшению резус-инфекции с каждой последующей беременностью, несовместимой с резус-фактором, у сенсибилизированной женщины также играет важную роль в процессе принятия решений.В представленном выше случае такой сценарий существовал. Вероятность беременности сенсибилизированной женщины от RhD-положительной гетерозиготы, имеющей RhD-положительный плод, составляет 50%. В таких парах использование ПГД для типирования RhD позволяет избирательно переносить только RhD-отрицательные эмбрионы, тем самым избегая любых осложнений, связанных с несовместимостью матери и плода. Представленный случай, насколько нам известно, является единственным циклом ПГД, завершившимся успешной беременностью.

    PGD был введен в 1990 году с первой установленной беременностью у двух пар, которые, как известно, подвержены риску передачи рецессивных Х-сцепленных заболеваний (Handyside et al., 1990). С тех пор его обычно предлагают при трех основных категориях заболеваний: связанных с полом, дефектов одного гена и хромосомных нарушений. Некоторые практикующие врачи также использовали ПГД для определения пола по социальному признаку и сопоставления по HLA. ПГД позволяет парам из группы риска избежать возможных осложнений или других неприятных событий при будущих беременностях.

    ПГД обязательно включает вспомогательные репродуктивные методы, при которых требуется стимуляция яичников и ЭКО для получения in vitro нескольких эмбрионов, чтобы выбрать непораженные эмбрионы для переноса.Это означает, что даже плодородные пары должны проходить процессы вспомогательной репродукции. Также необходимо учитывать финансовые затраты, связанные с ЭКО и ПГД. Однако экономические затраты на последующее наблюдение и лечение типичной беременности и новорожденного, страдающего тяжелым RhD, немаловажны вместе с психологическим и физическим бременем (van den Veyver et al. , 1995).

    Этот случай демонстрирует, что PGD можно использовать для определения статуса RhD эмбрионов на ранней стадии дробления с помощью анализа отдельных клеток.Это позволяет избирательно переносить только RhD-отрицательные эмбрионы, избегая развития гемолитической болезни у плода. Хотя беременность с повышенным риском, выявленная при пренатальной диагностике, может лечиться внутриматочной трансфузией, потенциальные осложнения, включая гибель плода, не всегда можно полностью предотвратить даже после этой процедуры. Прерывание беременности также может быть неприемлемым для пары. Фактически, генетический риск и возражения против прерывания беременности по-прежнему являются наиболее важными причинами для пар, ищущих ПГД, причем примерно у четверти пар есть один или несколько пострадавших детей (Руководящий комитет Консорциума ESHRE PGD, 2002).ПГД можно рассматривать как профилактическую меру лечения в парах, затронутых аллоиммунизацией RhD и мужской резус-положительной гетерозиготой.

    PGD был разработан для выявления генетических дефектов, но, как показывает этот случай, может использоваться для пар из группы риска с аллоиммунизацией RhD. Это дает избранным парам подход, позволяющий избежать риска рождения детей с гемолитической болезнью плода и новорожденного.

    Рисунок 1.

    Электрофореграмма, демонстрирующая: ( a ) RhD-отрицательную мать; ( b ) RhD-положительный отец; ( c ) RhD-отрицательный эмбрион и ( d ) RhD-положительный эмбрион.CE представляет собой генные продукты RHCE. D представляет продукт гена RHD. Идентификаторы ампликона, как показано в таблице 1, указаны на каждой панели.

    Рисунок 1.

    Электрофореграмма, демонстрирующая: ( a ) RhD-отрицательную мать; ( b ) RhD-положительный отец; ( c ) RhD-отрицательный эмбрион и ( d ) RhD-положительный эмбрион. CE представляет собой генные продукты RHCE. D представляет продукт гена RHD. Идентификаторы ампликона, как показано в таблице 1, указаны на каждой панели.

    Таблица I.

    Парные праймеры для генов резуса и короткие тандемные повторы

    Локус . Прямая грунтовка . Обратный праймер . Размер ампликона a (bp) .
    D1S199 б 6FAM-CCTGGGTGACAGAGTGAGACC TTTTCCCCTTCTCCCCTCC ~140
    D1S2674 б NED-CCAAAATCAACTGTCTCTGTAACAGTAA TCCAGCCTGGGAAACAGAAT ~240
    Rh48446d6 гр 6FAM-TCTGGGTGTTGGTTATGTGGG GCAGTCAGCAGGTTTGGGTT 162 (CE) / 168 (Д)
    Rh51712d4 с ВИК-CCCTATGATGAGACTGGTGGC CATGCTGCTGGCATCTGTTG 137 (CE) / 140 (D)
    Rh58925d3 c VIC-CAGGCGCCAGAGATCATTACT TCGTATTTCCCTTTCGTGGTG 109 (D) / 112 (CE)
    Locus 905 .
    Прямая грунтовка . Обратный праймер . Размер ампликона a (bp) .
    D1S199 б 6FAM-CCTGGGTGACAGAGTGAGACC TTTTCCCCTTCTCCCCTCC ~140
    D1S2674 б NED-CCAAAATCAACTGTCTCTGTAACAGTAA TCCAGCCTGGGAAACAGAAT ~240
    Rh48446d6 гр 6FAM-TCTGGGTGTTGGTTATGTGGG GCAGTCAGCAGGTTTGGGTT 162 (CE) / 168 (Д)
    Rh51712d4 с ВИК-CCCTATGATGAGACTGGTGGC CATGCTGCTGGCATCTGTTG 137 (CE) / 140 (D)
    Rh58925d3 c VIC-CAGGCGCCAGAGATCATTACT TCGTATTTCCCTTTCGTGGTG 109 (D) / 112 (CE)
    Таблица I.

    Парные праймеры для генов резуса и короткие тандемные повторы

    Локус . Прямая грунтовка . Обратный праймер . Размер ампликона a (bp) .
    D1S199 б 6FAM-CCTGGGTGACAGAGTGAGACC TTTTCCCCTTCTCCCCTCC ~140
    D1S2674 б NED-CCAAAATCAACTGTCTCTGTAACAGTAA TCCAGCCTGGGAAACAGAAT ~240
    Rh48446d6 гр 6FAM-TCTGGGTGTTGGTTATGTGGG GCAGTCAGCAGGTTTGGGTT 162 (CE) / 168 (Д)
    Rh51712d4 с ВИК-CCCTATGATGAGACTGGTGGC CATGCTGCTGGCATCTGTTG 137 (CE) / 140 (D)
    Rh58925d3 c VIC-CAGGCGCCAGAGATCATTACT TCGTATTTCCCTTTCGTGGTG 109 (D) / 112 (CE)
    Locus 905 .
    Прямая грунтовка . Обратный праймер . Размер ампликона a (bp) .
    D1S199 б 6FAM-CCTGGGTGACAGAGTGAGACC TTTTCCCCTTCTCCCCTCC ~140
    D1S2674 б NED-CCAAAATCAACTGTCTCTGTAACAGTAA TCCAGCCTGGGAAACAGAAT ~240
    Rh48446d6 гр 6FAM-TCTGGGTGTTGGTTATGTGGG GCAGTCAGCAGGTTTGGGTT 162 (CE) / 168 (Д)
    Rh51712d4 с ВИК-CCCTATGATGAGACTGGTGGC CATGCTGCTGGCATCTGTTG 137 (CE) / 140 (D)
    Rh58925d3 c VIC-CAGGCGCCAGAGATCATTACT TCGTATTTCCCTTTCGTGGTG 109 (D) / 112 (CE)

    Мы благодарим проф.Все процедуры ЭКО и ПГД проводились в Сиднейском ЭКО.

    Список литературы

    Abdalla MGK, Beattie B и Alfirevic Z (

    2004

    ) Методы внутриматочной трансфузии у плодов с несовместимостью резус (Протокол Кокрановского обзора). В Кокрановской библиотеке,

    , выпуск 2,

    . John Wiley & Sons Ltd, Чичестер, Великобритания,

    9

    стр.

    Avent ND и Reid ME (

    2000

    ) Система групп крови Rh: обзор.

    Кровь

    95

    ,

    375

    –387.

    Авент Н.Д., Лю В., Уорнер К.М., Моуби В.Дж., Джонс Дж. В., Риджвелл К. и Таннер М.Дж. (

    1996

    ) Иммунохимический анализ полипептидов Rh эритроцитов человека.

    J Biol Chem

    271

    ,

    14233

    –14239.

    Avner R, Reubinoff BE, Simon A, Zentner B, Friedmann A, Mitrani-Rosenbaum S и Laufer N (

    1996

    ) Управление изоиммунизацией резуса с помощью преимплантационной генетической диагностики.

    Mol Hum Reprod

    2

    ,

    60

    –62.

    Blunt T, Daniels G и Carritt B (

    1994

    ) Переключение серотипа в частично удаленном гене RHD.

    Vox Sang

    67

    ,

    397

    –401.

    Bowman J (

    2003

    ) Тридцать пять лет профилактики резус-фактора.

    Переливание

    43

    ,

    1661

    –1666.

    Bowman JM и Pollock JM (

    1987

    ) Неудачи внутривенной профилактики резус-иммуноглобулином: анализ причин таких неудач.

    Transfus Med Ред.

    1

    ,

    101

    –112.

    Cherif-Zahar B, Mattei MG, le Van Kim C, Bailly P, Cartron JP и Colin Y (

    1991

    ) Локализация структуры гена группы крови Rh человека в области 1p34.3–1p36.1 хромосомы in situ гибридизация.

    Hum Genet

    86

    ,

    398

    –400.

    Colin Y, Cherif-Zahar B, Le Van Kim C, Raynal V, Van Huffel V и Cartron JP (

    1991

    ) Генетическая основа полиморфизма RhD-положительных и RhD-отрицательных групп крови, определенная с помощью анализа по Саузерну.

    Кровь

    78

    ,

    2747

    –2752.

    Crowther C и Middleton P (

    2004

    ) Введение анти-D после родов для предотвращения аллоиммунизации резус (Кокрановский обзор). В Кокрановской библиотеке, выпуск 2, 2004 г. John Wiley & Sons Ltd, Чичестер, Великобритания.

    Cui XF, Li HH, Goradia TM, Lange K, Kazazian HH Jr, Galas D и Arnheim N (

    1989

    ) Типирование одного сперматозоида: определение генетической дистанции между локусами G-гамма-глобина и паратироидного гормона с помощью полимеразная цепная реакция и аллель-специфические олигмеры.

    Proc Natl Acad Sci USA

    86

    ,

    9389

    –9393.

    Даффос Ф, Капелла-Павловский М. и Форестье Ф. (

    1985

    ) Взятие пробы крови плода во время беременности с использованием иглы под контролем ультразвука: исследование 606 последовательных случаев.

    Am J Obstet Gynecol

    153

    ,

    655

    –660.

    Руководящий комитет Консорциума ESHRE PGD (

    2002

    ) Консорциум по преимплантационной генетической диагностике: сбор данных III (май 2001 г.).

    Hum Reprod

    17

    ,

    233

    –246.

    Handyside AH, Kontogianni EH, Hardy K и Winston RML (

    1990

    ) Беременности от предимплантационных человеческих эмбрионов, взятых после биопсии, с разбивкой по полу с помощью Y-специфической амплификации ДНК.

    Природа

    344

    ,

    768

    –770.

    Льюис М., Кайта Х. и Чоун Б. (

    2000

    ) Наследование резус-групп крови: частота в 1000 неродственных кавказских семьях, состоящих из родителей и 2806 детей.

    Vox Sang

    20

    ,

    500

    –508.

    MacGeoch C, Mitchell CJ, Carritt B, Avent ND, Ridgwell K, Tanner MJ и Spurr NK (

    1992

    ) Назначение хромосомного локуса человеческого 30-кДал-резус (резус) связанного с антигеном белка группы крови ( Rh40A) в область хромосомы 1p36.13 – p34.

    Cytogenet Cell Genet

    59

    ,

    261

    –264.

    MacGregor SN, Silver RK и Sholl JS (

    1991

    ) Повышенная сенсибилизация после кордоцентеза у беременных с резус-изоиммунизацией.

    Am J Obstet Gynecol

    165

    ,

    382

    –383.

    Mouro I, Colin Y, Cherif-Zahar B, Cartron JP и Le Van Kim C. (

    1993

    ) Молекулярно-генетическая основа системы групп крови резуса человека.

    Нат Генет

    5

    ,

    62

    –65.

    NHMRC (

    1999

    ) Руководство по профилактическому применению иммуноглобулина Rh D (анти-D) в акушерстве.

    NHMRC (

    2003

    ) Руководство по профилактическому применению иммуноглобулина Rh D (анти-D) в акушерстве.

    Nicolini U, Kochenour NK, Greco P, Letsky EA, Johnson RD, Contreras M и Rodeck CH (

    1988

    ) Последствия кровотечения у плода после внутриматочного переливания.

    Br Med J

    297

    ,

    1379

    –1381.

    Smythe JS, Avent ND, Judson PA, Parsons SF, Martin PG и Anstee DJ (

    1996

    ) Экспрессия продуктов генов RHD и RHCE с использованием ретровирусной трансдукции клеток K562 устанавливает молекулярную основу антигенов группы крови Rh.

    Кровь

    87

    ,

    2968

    –2973.

    van den Veyver IB, Chong SS, Cota J, Bennett PR, Fisk NM, Handyside AH, Cartron JP, Le van Kim C, Colin Y, Snabes MC et al. (

    1995

    ) Плод-плацента-новорожденный: одноклеточный анализ группы крови RhD для использования в предимплантационной диагностике для профилактики тяжелой гемолитической болезни новорожденных.

    Am J Obstet Gynecol

    172

    ,

    533

    –540.

    Верлинский Ю., Речицкий С., Скулкрафт В., Стром С. и Кулиев А. (

    2001

    ) Преимплантационная диагностика анемии Фалькони в сочетании с HLA-сопоставлением.

    J Am Med Assoc

    285

    ,

    3130

    –3133.

    Верлинский Ю., Речицкий С., Озен С., Маскиангело С., Айерс Дж. И Кулиев А. (

    2003

    ) Преимплантационная генетическая диагностика генотипа Kell.

    Fertil Steril

    80

    ,

    1047

    –1051.

    Заметки автора

    1 Отделение акушерства, Сиднейский университет, Королевская больница Северного побережья, Отделение акушерства, Госпиталь Королевского Северного побережья, Сидней, Австралия 2065, и 3 Сиднейское ЭКО и 4 ЭКО Австралия, Сидней, Австралия 2000

    Репродукция человека Том.20 № 3 © Автор 2005; все права защищены

    Суррогатные матки и группа крови — Суррогатная беременность

    Любой родитель может сказать вам, что понимание биологической стороны беременности требует времени, исследований и многочисленных обсуждений с медицинским работником. Но даже тогда, когда на каждый ответ был дан ответ, в течение этих девяти месяцев возникает еще один вопрос. Для родителей, использующих суррогатное материнство, может возникнуть еще больше вопросов, включая вопросы о суррогатных матерях и группе крови.

    ДНК и суррогат

    Суррогатная мать вынашивает ребенка с чужой ДНК, а не с ее собственной. Она не вносит генетический материал в создание эмбриона. Есть вероятность, что крошечный кусочек суррогатной ДНК передается во время беременности, но это настолько крошечный объем, что не имеет значения.

    ДНК ребенка поступает от его или ее биологических родителей. Половина поступает от матери, а половина — от отца. В результате вам не придется слишком беспокоиться о суррогатах и ​​группе крови.

    Группа крови и выбор донора яйцеклеток

    Если вам нужен донор яйцеклеток, стоит ли беспокоиться о группе крови?

    Есть три группы крови: A, B и O. Некоторые типы встречаются реже, чем другие. Выбирая донора яйцеклеток, вы заменяете биологию предполагаемой матери на донора яйцеклеток. Многие родители часто выбирают донора на основании физических характеристик, таких как цвет волос и глаз, рост, этническая принадлежность, образование и личность.

    Существует небольшой потенциальный риск заболеваний, если суррогатная мать и ваш ребенок имеют разные группы крови.Антитела к группе крови ABO имеют большие размеры и не могут проникать через плаценту между суррогатной матерью и ребенком.

    Коэффициент относительной влажности

    суррогатов CSP проходят тщательную проверку здоровья и серию тестов, прежде чем будут одобрены для участия в нашей программе. Анализ крови определяет резус-фактор каждого суррогата, который является либо положительным, либо отрицательным. Положительный резус-фактор означает, что у нее есть резус-фактор, антиген, переносимый эритроцитами. Отрицательный резус-фактор означает, что ее нет.

    Ваш ребенок может унаследовать резус-фактор от своего биологического отца или матери.Около 85% населения европеоидной расы резус-положительное. Число азиатов, афроамериканцев и коренных американцев еще выше. Остается от 10% до 15% людей с отрицательным резус-фактором.

    Если женщина с отрицательным резус-фактором вынашивает ребенка с положительным резус-фактором, клетки крови ребенка могут попасть в ее кровеносную систему. Ее иммунная система может воспринять это как чужеродное вещество и атаковать ребенка. Это может привести к развитию у ребенка анемии, называемой резус-болезнью.

    Если суррогатная мать имеет отрицательный резус-фактор, а биологические родители положительны, суррогатная мать получит прививку RhoGAM на 28 и 34 неделе, а затем снова после родов.Вакцинация RhoGAM предотвращает сенсибилизацию к резус-фактору, который защищает ребенка.

    Получите ответы о суррогатах и ​​группе крови

    Суррогатное материнство требует, чтобы предполагаемые родители и суррогатная мать делились личной и личной информацией, касающейся истории болезни, психологического здоровья, финансовой информации и т. Д. Медицинские и личные обследования, в том числе связанные с группой крови и резус-фактором, необходимы для успешного суррогатного материнства и рождения здорового ребенка.

    Ваш куратор по программе CSP будет рад ответить на все ваши вопросы о суррогатах и ​​группе крови, чтобы вы могли быть уверены, что ваш ребенок будет в безопасности и защищен, вплоть до того дня, когда вы встретитесь с ним или с ней. самый первый раз.

    Несовместимость по системе ABO у новорожденных (беременность, роды и позднее)

    Несовместимость по системе ABO является распространенным и обычно легким типом гемолитической болезни у младенцев. Термин гемолитическая болезнь означает, что эритроциты разрушаются быстрее, чем обычно, что может вызвать желтуху, анемию и в очень тяжелых случаях может привести к смерти. Во время беременности этот распад красных кровяных телец у ребенка может произойти, если группы крови матери и ребенка несовместимы и если эти разные группы крови вступают в прямой контакт друг с другом и образуются антитела.

    Значительные проблемы с несовместимостью по системе ABO возникают в основном у младенцев, матери которых имеют группу крови O, а ребенок — группы крови A или B. У недоношенных детей гораздо больше шансов столкнуться с серьезными проблемами из-за несовместимости по системе ABO, в то время как у здоровых доношенных детей это, как правило, лишь незначительно. В отличие от гемолитической болезни, которая может привести к появлению последующих детей, если у матери отрицательная группа крови, несовместимость по системе ABO может возникнуть у первенцев и не станет более серьезной при последующих беременностях.

    Чтобы понять несовместимость по системе ABO, полезно просмотреть различные группы крови. Гены, которые вы унаследовали от родителей, определяют вашу группу крови. Есть четыре группы крови; A, B, AB и O. Каждая группа крови имеет свой собственный индивидуальный набор химических веществ на поверхности клеток крови, известных как антигены, поэтому тип A имеет антиген A, B имеет антиген B, AB имеет оба антигена, а O не содержит антигена. . Если смешиваются разные группы крови, возникает иммунный ответ, и человек вырабатывает антитела для атаки на чужеродный антиген крови.

    Желтуха ребенка

    Во время беременности кровь матери и ребенка обычно не смешивается. Кровообращение матери и ребенка разделено плацентарной мембраной. Кислород, углекислый газ, питательные вещества, некоторые лекарства и некоторые вирусы могут проходить через плацентарную мембрану. Однако некоторые обстоятельства могут привести к смешению двух групп крови, например, выкидыш, травма и роды, а иногда они могут смешиваться по неизвестным причинам. Могут образовываться антитела против чужеродных групп крови A и B.Эти антитела могут затем пройти через плацентарную мембрану в кровоток ребенка и могут привести к разрушению некоторых красных кровяных телец ребенка. Это разрушение эритроцитов вызывает увеличение производства билирубина — продукта жизнедеятельности. Если вырабатывается слишком много билирубина, это может нарушить нормальные процессы выведения шлаков у ребенка и привести к желтухе.

    Желтуха вызывается билирубином — желтым пигментом, придающим коже и белкам глаз новорожденного желтый цвет.Цвет ребенка определяется во время регулярных осмотров новорожденных акушеркой или врачом. Ребенку могут потребоваться анализы крови, чтобы проверить уровень билирубина, если ребенок выглядит значительно желтушным. Легкая желтуха очень часто встречается у новорожденных и не требует последующего наблюдения. Младенцам с высоким уровнем билирубина в крови потребуется фототерапия, а в тяжелых случаях может потребоваться обменное переливание крови.

    Ребенок, имеющий фототерапию

    У младенцев, страдающих несовместимостью по системе ABO, анемия может стать проблемой через несколько недель.Анемия вызывается более быстрым, чем обычно, разрушением красных кровяных телец ребенка, вызванным материнскими антителами. Эти антитела могут оставаться в кровотоке ребенка в течение нескольких недель после рождения.

    Написать ответ

    Ваш адрес email не будет опубликован.